Busch Lab

ZMP

si:dkey-259j3.5

Ensembl ID:
ENSDARG00000093822
ZFIN ID:
ZDB-GENE-091204-113
Human Orthologue:
AC118759.1
Human Description:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NP22]
Mouse Orthologues:
BC051076, Prol1
Mouse Descriptions:
cDNA sequence BC051076 Gene [Source:MGI Symbol;Acc:MGI:2670982]
proline rich, lacrimal 1 Gene [Source:MGI Symbol;Acc:MGI:107496]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa11602 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11602
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000148043 Essential Splice Site 17 215 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36353388)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35386090
GRCz11 10 35329950
KASP Assay ID:
2260-3497.1 (used for ordering genotyping assays)
KASP Sequence:
ATGTTTYCTACAGATCATGTTAAAAATCACAGCATGAAACTGTCCACAAG[G/A]TATGTCATTTTRTGTTTATATGATTGWCTATATGTAAATGTGATGGTGAT
Associated Phenotype:
Not determined