Busch Lab

ZMP

si:dkey-23o4.5

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36215 Nonsense Mutation detected in F1 DNA Not yet available
sa8599 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36215
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144852 Nonsense 110 220 5 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 40786646)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38171446
GRCz11 16 38121478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTCATCTTGGCACCAGGAGGAGGTGGACTGGGCACTGTGGCTCTGTCA[C/T]AGGTTCTCCTGCCTGGAACATCTATTGCCAATGTTACCAACAGTCAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8599
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144852 Nonsense 148 220 6 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 40786859)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38171659
GRCz11 16 38121691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGGGTCTTCCTGTCCAGAATATCCAGCCTGGCCAGGGTCCAATGAGTT[T/G]AGTGCTGAATGTYCAACAAGGCCAAACTGTTCGACCGATTACTCTACTCC
Associated Phenotype:
Not determined