Busch Lab

ZMP

si:ch211-202a12.9

Ensembl ID:
ENSDARG00000093779
ZFIN ID:
ZDB-GENE-060526-79
Description:
Novel protein containing a small cytokines (Intecrine/chemokine), interleukin-8 like domain [Source:
Human Orthologue:
CXCL11
Human Description:
chemokine (C-X-C motif) ligand 11 [Source:HGNC Symbol;Acc:10638]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa31469 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31469
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137224 Essential Splice Site 92 121 3 4
Genomic Location (Zv9):
Chromosome 5 (position 43689607)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 41470872
GRCz11 5 42071025
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGACTCAAAATTCACCAAAAATGTCGTCTTAAAGGCTATTGGGAAAAG[G/T]TGAGAATTTCTGCTTAAGTATATTTATGTCTGCTTCACAGATATATTCAC
Associated Phenotype:
Not determined