Busch Lab

ZMP

si:ch211-147g15.1

Ensembl ID:
ENSDARG00000093752
ZFIN ID:
ZDB-GENE-081104-123
Description:
Novel protein similar to vertebrate RIMS binding protein 2 (Rimbp2) [Source:UniProtKB/TrEMBL;Acc:B0V
Human Orthologue:
RIMBP2
Human Description:
RIMS binding protein 2 [Source:HGNC Symbol;Acc:30339]
Mouse Orthologue:
Rimbp2
Mouse Description:
RIMS binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2443235]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3694
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147869 Essential Splice Site 34 51 1 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 46121800)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44021689
GRCz11 8 44015108
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATTGGCCGTCCTCAGTGCCAAGCAGCAGGAGATTGACCTTCTGCAGAAG[G/A]TGAGAGGCCACACYAGACCCCAGGATCCACTGCAGAAGACCCCGTGTCGT
Long Flanking Sequence:
GACCTGCTTCACCCAAAAGTGAATATTTGATCATTTACTCACCCTAATGGCTGTCTAAATGCAAAAATACAATCATTTCAGTTTTCTTGTTCCCTGTATAGAACAAAAAGTAGTTCTCAACAAGCATGTCTAAGCTGCTGTTTTACTATAAAACTCAATAGCTAATGATTGCTGGTCCTCATCTGCTTTCATCTGCATGAAAACAAAAGCAGCTTGGACATTCTTCTTAATATCTTCTTTTTGCGTTCCATTCAAGAAAGTAAGTCATCATGAGGGTGAGTAAAAGATAAGATGGTTTTCTTTTTTTGGGTGAGCTGTCCCTTTATGAATGATTGATGGATGCTCTCATTCTGTCCTCCTGCTTTCTCTCTCTCTCTCTCTTCTGTGTTTTCCAGCATATGCGAGAGGCTGCGGAGAGGAGGCAGCAGCTAGAATTAGAGCATGAACAAGCATTGGCCGTCCTCAGTGCCAAGCAGCAGGAGATTGACCTTCTGCAGAAG[G/A]TGAGAGGCCACACCAGACCCCAGGATCCACTGCAGAAGACCCCGTGTCGTGTCTCAAATGACAAGGTTTCTGGTGGATGATTAAACAGAAGTCATTAATTTAGAGCACATTCTGCTGATACAGTAGATGATTTTTACTTGGTTTCAGACTGGTTCAAGCTGGTGTGGATGGTTAAAGGAACAGAAAGAAAGTATTGTCAAAAATATTGAGTCTGGAACCAATCGGTACAGAATATTTACAAACGTCATTTCCCGCAAACATTTAAGCACAGTTGAGTGCATATTTAAACAAAGCTGATTGGTCATTGGGTTCATGTACTTAATAGAAATGACTGTGATTGGCCGTGAAGGTCAACTCGTCATTGCTGTTCACCAAGTGCAAACACAGATAGACAGACAGTGGATCATTTCAAAGCAGCGTAAAGGTACCAGTGTCTAATGACATAGATACTTACAACAACCATACTCTCATTCTGGAGTAATAATCAAAGATCTTTGCTG
Associated Phenotype:
Not determined