Busch Lab

ZMP

ftr25

Ensembl ID:
ENSDARG00000093651
ZFIN ID:
ZDB-GENE-070912-323
Description:
Novel protein with Zinc finger, C3HC4 type (RING finger) and B-box zinc finger domains [Source:UniPr
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33022 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5168
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098047 Essential Splice Site 307 553 3 8
ENSDART00000143023 Essential Splice Site 307 360 3 4
Genomic Location (Zv9):
Chromosome 2 (position 48042771)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48074435
GRCz11 2 47928599
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAGCTGGAGCAGCTTTCACACACTGATGATCACATACATTTCCTACAG[G/A]TAGCAGTGAAATGGAAAACATGAACTTTAGGATCATCCTATTATCACAGA
Long Flanking Sequence:
ATAGAACCTTTGAATTATGGATTTAAGGAAAAGTACTGATTAGTGTGTTTACATTTGTTCCATGTTGCAGAAACCCTTGGGGGGTGTTCAAAGAAAATTTGATCTTAGAATCAAGAGAAAACAGAAGCTGCTATATCAGCTAAAAGAGGCTGTGGAGACTCATAAGGTCAGTTTTAAAGTTTTAATGAGGATATATTTAAGAGTATTTTAAGTCCTACTCCTGAAACTCACCAAGAGCTAGTCTGATTATCTGTATTCTCTACCAGAGCTCTGCTCAGAAAGCAGTGGAGGACAGTGAGAGGATCTTCAGTGAACTCATCCAGTCCATTGAGAGAAGACGATCTGAGGTCACACAGATGATCAGAGATCGAGAAAAGACTGAAGTGAGTCGAGCTGAAGGACTCTTGAAGAAACTGGAGGAGGAGATTGAAGATCTGAAGAGGAGAAACACTGAGCTGGAGCAGCTTTCACACACTGATGATCACATACATTTCCTACAG[G/A]TAGCAGTGAAATGGAAAACATGAACTTTAGGATCATCCTATTATCACAGAAAGGTCAGGTCATTGTATTTAATTCACTAGCGATGGAGACAGATTTTCATTGTTTTTTCTTTATGGGCTTTTGCACCAGGTTATGAACTATAGGATTAGCCACCAGGCCAGATCTCTAAGAACTAAATATCCTATCTAACCATTTTCCTGATTGCATTCACACAATCACTAGACATTTTTATGTAAGGACACACAGACAGTGATATAAGCATCCCAACAAAATCAACCAGTGGAGGATAGAGGAGCTGGGTTTCTAATGTGTTGTGATAAAGGAGATGAATATAAATGTCAATTTTATGCAACTGAAAAAGCAAACAAGTGGACTAAACCACAAATATGTAGTGCTAAATATCCCCAAAGCTGAGAAAACAACACACTTTCGCTAATGGATCTAGGAGTTAATAAAGCTCCTCGAGTGCTTATACAAAAAGACGTTACTGATTCAAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33022
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098047 Nonsense 546 553 8 8
ENSDART00000143023 None None 360 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 48047557)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48079221
GRCz11 2 47933385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACAACATTCACTCAACCGCTCTACCCTGGGTTTGGGATTAATTTTGGAT[C/A]AACAATAAAACTTCTATTGTTGAAGTCCTTATGAACTATAAGATAATTTA
Long Flanking Sequence:
GTGTCATCTCACCCTGGATTTAAACACTGCACATAAATATCTCCGTCTGTCTGAAGGAAACAGAGTGGCTACTTTTATTGGAGCTGACCAGAGTTACCCGGCTCACCCGGACAGATTTCATGACTTTTCCCAGGTGTTGTGCAGAGAGAGTGTGTGTGGACGCTGTTATTGGGAGGTGGAGTGGAGCGGGGAGGCTGGAGTGGGAATATCAGTCTCATATAAGAGCATCAGAAGAAAAGAAGAGACTAATGATTCCGTGTTTGGATACAATGGTCAGTCCTGGAGATTGTCCTGCTCTAACTCCAGCTATAAATTCAGACACAATAGCAATGTTGTTGATCTCCCTGTATCTTCCAAATCCTCTAAAATAGGAGTGTATGTGGATCACAGAGCAGGAATTCTGTCCTTCTTCAGTGTCTCTGACACAATGAGCCTCATCCACAGAGTCCAGACAACATTCACTCAACCGCTCTACCCTGGGTTTGGGATTAATTTTGGAT[C/A]AACAATAAAACTTCTATTGTTGAAGTCCTTATGAACTATAAGATAATTTATACATCCTCATGAAAAATGCAGATAGGAAATGTGGTAAACAGCTTCCTCTATCTTTCTGGTGATTATCATTTTAATCCACACACACACTATTTTTTCTTTATATTAAATTAGTCTAATATACTCATTAAATATCTCCCATAACACACTGTGCAGGTCTGTGTCCAGGGCACAATACAAGGGAACCCTATTGGATTTCTTTTCCTTTTGTTGTAATTGTAATTAAACACAATCCCGTAGGAGCTACTGATGCGTAGACACAGTTCACACAACCCATACAAGCAATAGAGCTGTTTCTTCTTTAAGAAGAGAAGTGTTGTTTCTCCTTTAAGAGAAGGAGGTTTGGAGTTTTGTGAGTTTTGAAATTGAGTGATACCTGCCTCTGTGCATTTTTGTTAGCACAACATCTATAATCCAGTGAATGTGTAAGAATTAGGTGCGTATAATGTCTT
Associated Phenotype:
Not determined