Busch Lab

ZMP

si:ch211-249h16.8

Ensembl ID:
ENSDARG00000093630
ZFIN ID:
ZDB-GENE-090311-36

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa38774 Nonsense Mutation detected in F1 DNA Not yet available
sa27547 Nonsense Mutation detected in F1 DNA Not yet available
sa41583 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa41582
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141692 Essential Splice Site 142 597 2 10

The following transcripts of ENSDARG00000093630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5155091)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5151385
GRCz11 10 5151689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACCGTCGCAGCACATGCAGACCTTGAGCCGGTGTGGCTGCCAGGCCAG[G/A]TCTGTGAAGATCCCCAGCTGTTGAGTATTCCGGGCCCCTCCAGGATCAAT
Long Flanking Sequence:
AAAATTCTGTGCAGACATAGCAGAAAGTGAGCGCAGATTCCGTCTGGCCCTATTTATGTCTAATATGGACTCATGACTTACGGACTATTTATCAGGTTGTATTTGTCTTTGCAATTTCACGTAATTTTAGTTTTCAAACATTTTCTATTATAATTGTACATTTTATTTTTGTTGTTTCTTGTGTGTGATTGTCTTGATATGTCTACTTACAGCAGTTTGTCTATTTTAAACCTGTGGTTAAAGAGTTTTCTAACATTTCCCTGTTCATTTTCTTTACTTTAGAAAACCCAGAGAAAGGAAGGAAAGGGAATAAAGCCTCTGCTTTCTTTAAGAGAGCATGGAAGGCTGTGAAGCGCCCTTTCCTTTGCTGTGACCGGAGCAGAGTGGTTCCCTTTGAACCACGGTCAGAAGTCGACGATTTCGAGCACCTGCCTGTTCCAGGTCCTTCCAGGACCGTCGCAGCACATGCAGACCTTGAGCCGGTGTGGCTGCCAGGCCAG[G/A]TCTGTGAAGATCCCCAGCTGTTGAGTATTCCGGGCCCCTCCAGGATCAATGCAGATCCGGCCCGTCCTGAGTCCTCGACGGCCCTCACAGGTCATGTTGACCCTGAGCTTGTGCGTCCGCCAGTCCAGGTCTGCGACCGTCTTGAGTCGTTAGCTGTTCCAGGAACATCCAAGATCAAGCCAACGACCATCGCAGATCATGTTGACCCTGAGCAGATGCGTCCGCCAGTCCAGATCTGTGAAGACTCTCAGTCGTTGAGTGTTCCGGGCCCCTCCAGGATCAAGCATGATGTGCTGAATGCAGATCCGGCCCGTCCTGAATCCTCAACGGCCCTCACGGGTCATGTTGATACTGAGCTGCCAGGCCAGATCTGTGAAGATCCTCGGCTAATCAGTGTCCATGGCCCCTCCAATATTAAGACAATGACGGATGCAGATTCGGCCTGTCCTGAGTCGCCTCCGTCTGTTCAAGACCCCTCTAAAATTGATGGGACTGATGGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27546
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141692 Nonsense 305 597 4 10

The following transcripts of ENSDARG00000093630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5155985)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5152279
GRCz11 10 5152583
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAAAGTTACGCCTGGAATTGCAGATCCAGCTGACCCTGAGTCAGTCTG[T/A]CTGCCAGGCCAGGTTTCTGATGAACCTAACAAGCCTTTTGATCTCACTGT
Long Flanking Sequence:
GTGTCCATGGCCCCTCCAATATTAAGACAATGACGGATGCAGATTCGGCCTGTCCTGAGTCGCCTCCGTCTGTTCAAGACCCCTCTAAAATTGATGGGACTGATGGTGAGTCCTCCTGAATTTGGTTCATTTTATTTCTGCCATCTGTCATTTTTCATGCTTTGTTGTTTTTAGCTTAAACATCAGACAGTGTCACTTGTTGTACTATTGGTTGTGTATTAATTATTAGCTGCAGCTCTGCTCATGGAGATGTTTCTGTTTGCTTTCTTCATTTTAGAAAAACCCAAGAAAGGAAGGAAAGGGAAAAGAGTCTCTGCTTTCTTCAAGAGAGTATGGAAGGCTGTAATGCGCCCTTTCCTGTGCTGTGACACAGATAAAGTCCAGCATCTTACACCACAACCTGAGCCAAAGCCAGAACCAGAGCCAGAGCCTGAGGATGAAGCAGTGCCTGTTAAAGTTACGCCTGGAATTGCAGATCCAGCTGACCCTGAGTCAGTCTG[T/A]CTGCCAGGCCAGGTTTCTGATGAACCTAACAAGCCTTTTGATCTCACTGTTGGTAAGTCATCATTACCTTCCATTTCCTGTAATTCATAATTAATATAAATGAGTAATTACTTTACTCCTGCAATTCTTATGAAAGTTACTGCTCATTGCATTAGATCCAGATTCAAAGTATAGGAGTCGTTTATTTGATCCGTTTCACATCAGACAATCCAAGTAAATCTCCCTGCTCTTTTTCTGTGTGTTTTTCAGGATCTGTGGTGTCTCATTTTAAAGTCAGAAACATGATTGGACAAGGAGCTTTTGGCCAGGTGTATTTGGCGTCTGACGTATCAAGTGAAAAAGAAAAGGTAGAGAAGTATTTCTAAGATTCAAACAATATTTTTATCCAGATTATTATTAAATATGAATAAATTATAGGCGTCAATTTGATGTTTATTCTGAAAAATGTACCATTTTTTTTTCTTGCAGGTTGCCCTGAAGTATATCATCAAGCAAAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38774
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141692 Nonsense 337 597 5 10

The following transcripts of ENSDARG00000093630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5156276)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5152570
GRCz11 10 5152874
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTTCAGGATCTGTGGTGTCTCATTTTAAAGTCAGAAACATGATTGGA[C/T]AAGGAGCTTTTGGCCAGGTGTATTTGGCGTCTGACGTATCAAGTGAAAAA
Long Flanking Sequence:
GGAAGGAAAGGGAAAAGAGTCTCTGCTTTCTTCAAGAGAGTATGGAAGGCTGTAATGCGCCCTTTCCTGTGCTGTGACACAGATAAAGTCCAGCATCTTACACCACAACCTGAGCCAAAGCCAGAACCAGAGCCAGAGCCTGAGGATGAAGCAGTGCCTGTTAAAGTTACGCCTGGAATTGCAGATCCAGCTGACCCTGAGTCAGTCTGTCTGCCAGGCCAGGTTTCTGATGAACCTAACAAGCCTTTTGATCTCACTGTTGGTAAGTCATCATTACCTTCCATTTCCTGTAATTCATAATTAATATAAATGAGTAATTACTTTACTCCTGCAATTCTTATGAAAGTTACTGCTCATTGCATTAGATCCAGATTCAAAGTATAGGAGTCGTTTATTTGATCCGTTTCACATCAGACAATCCAAGTAAATCTCCCTGCTCTTTTTCTGTGTGTTTTTCAGGATCTGTGGTGTCTCATTTTAAAGTCAGAAACATGATTGGA[C/T]AAGGAGCTTTTGGCCAGGTGTATTTGGCGTCTGACGTATCAAGTGAAAAAGAAAAGGTAGAGAAGTATTTCTAAGATTCAAACAATATTTTTATCCAGATTATTATTAAATATGAATAAATTATAGGCGTCAATTTGATGTTTATTCTGAAAAATGTACCATTTTTTTTTCTTGCAGGTTGCCCTGAAGTATATCATCAAGCAAAGCCATGACCGTTATCTCAAGATTGTAAGTTGAACAATTTACACATCAATGAAAATGTGCTGACCATTAATTCATCCTTCACTTGTCCCGTACCTGTCTGGACCACTTGAAACTGAGTTCAAAAGCAGATATGGTGGAAACAAGTAGCCACTGACTTTCATCGTAGAAAAAGAAAATACTTTAGAGAGTCAATGCTTAACAGGTTTTCAACATTCTTCAAAATATCTTCTTTTGTGTTCAGTAGAAGAAACCCAGAGACAAGTTTTGAACACATGAATGAAAATAATTTGTAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27547
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141692 Nonsense 344 597 5 10

The following transcripts of ENSDARG00000093630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5156299)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5152593
GRCz11 10 5152897
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTTAAAGTCAGAAACATGATTGGACAAGGAGCTTTTGGCCAGGTGTA[T/A]TTGGCGTCTGACGTATCAAGTGAAAAAGAAAAGGTAGAGAAGTATTTCTA
Long Flanking Sequence:
TGCTTTCTTCAAGAGAGTATGGAAGGCTGTAATGCGCCCTTTCCTGTGCTGTGACACAGATAAAGTCCAGCATCTTACACCACAACCTGAGCCAAAGCCAGAACCAGAGCCAGAGCCTGAGGATGAAGCAGTGCCTGTTAAAGTTACGCCTGGAATTGCAGATCCAGCTGACCCTGAGTCAGTCTGTCTGCCAGGCCAGGTTTCTGATGAACCTAACAAGCCTTTTGATCTCACTGTTGGTAAGTCATCATTACCTTCCATTTCCTGTAATTCATAATTAATATAAATGAGTAATTACTTTACTCCTGCAATTCTTATGAAAGTTACTGCTCATTGCATTAGATCCAGATTCAAAGTATAGGAGTCGTTTATTTGATCCGTTTCACATCAGACAATCCAAGTAAATCTCCCTGCTCTTTTTCTGTGTGTTTTTCAGGATCTGTGGTGTCTCATTTTAAAGTCAGAAACATGATTGGACAAGGAGCTTTTGGCCAGGTGTA[T/A]TTGGCGTCTGACGTATCAAGTGAAAAAGAAAAGGTAGAGAAGTATTTCTAAGATTCAAACAATATTTTTATCCAGATTATTATTAAATATGAATAAATTATAGGCGTCAATTTGATGTTTATTCTGAAAAATGTACCATTTTTTTTTCTTGCAGGTTGCCCTGAAGTATATCATCAAGCAAAGCCATGACCGTTATCTCAAGATTGTAAGTTGAACAATTTACACATCAATGAAAATGTGCTGACCATTAATTCATCCTTCACTTGTCCCGTACCTGTCTGGACCACTTGAAACTGAGTTCAAAAGCAGATATGGTGGAAACAAGTAGCCACTGACTTTCATCGTAGAAAAAGAAAATACTTTAGAGAGTCAATGCTTAACAGGTTTTCAACATTCTTCAAAATATCTTCTTTTGTGTTCAGTAGAAGAAACCCAGAGACAAGTTTTGAACACATGAATGAAAATAATTTGTAACATAAATGGAGATAAAAATGATCATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27548
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141692 Essential Splice Site 372 597 6 10

The following transcripts of ENSDARG00000093630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5156505)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5152799
GRCz11 10 5153103
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCCCTGAAGTATATCATCAAGCAAAGCCATGACCGTTATCTCAAGATT[G/A]TAAGTTGAACAATTTACACATCAATGAAAATGTGCTGACCATTAATTCAT
Long Flanking Sequence:
ATGAACCTAACAAGCCTTTTGATCTCACTGTTGGTAAGTCATCATTACCTTCCATTTCCTGTAATTCATAATTAATATAAATGAGTAATTACTTTACTCCTGCAATTCTTATGAAAGTTACTGCTCATTGCATTAGATCCAGATTCAAAGTATAGGAGTCGTTTATTTGATCCGTTTCACATCAGACAATCCAAGTAAATCTCCCTGCTCTTTTTCTGTGTGTTTTTCAGGATCTGTGGTGTCTCATTTTAAAGTCAGAAACATGATTGGACAAGGAGCTTTTGGCCAGGTGTATTTGGCGTCTGACGTATCAAGTGAAAAAGAAAAGGTAGAGAAGTATTTCTAAGATTCAAACAATATTTTTATCCAGATTATTATTAAATATGAATAAATTATAGGCGTCAATTTGATGTTTATTCTGAAAAATGTACCATTTTTTTTTCTTGCAGGTTGCCCTGAAGTATATCATCAAGCAAAGCCATGACCGTTATCTCAAGATT[G/A]TAAGTTGAACAATTTACACATCAATGAAAATGTGCTGACCATTAATTCATCCTTCACTTGTCCCGTACCTGTCTGGACCACTTGAAACTGAGTTCAAAAGCAGATATGGTGGAAACAAGTAGCCACTGACTTTCATCGTAGAAAAAGAAAATACTTTAGAGAGTCAATGCTTAACAGGTTTTCAACATTCTTCAAAATATCTTCTTTTGTGTTCAGTAGAAGAAACCCAGAGACAAGTTTTGAACACATGAATGAAAATAATTTGTAACATAAATGGAGATAAAAATGATCATTGCGTCATATCCCCCATAGCCCCTTGTAAAGCAGTCTGCATTCATTTCTACGCTCAGTTACACGTGGAAATCGGTGAAATTATGTAACGTGACTTTTGCAGCATGGGATGTGCTTTATTCATCTTTATTCTTTATTCAAATGCTGATTTATTTAACAGTGCTGAAGAGAGTGTGTGCTGTTGTGTGTGTGCTCAGCCTCAGAGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41583
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141692 Nonsense 445 597 7 10

The following transcripts of ENSDARG00000093630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5158764)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5155058
GRCz11 10 5155362
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAAAGACATCGGACATGGATGAAAACAAAGCACGCCGGTTAATGCGT[C/T]AGTTGGTCCAAGCTGTCAAGTTCTGCGTTGAACGTGGAGTTTTCCATGGT
Long Flanking Sequence:
AACTGGTCTCCACCGCTTTCCTGATTTTTTTCAAACTAGAGGTGTGAAAACACCCTGCTGAAACAGGAGTTTTGTGGCCCTTTAATTAAACCAAAAAAGACAAGGAAGGAATCACTCATCGCTCTTGACTAAATGATTTAGTAGCTTTAATAAGACTGTTTCATTTGGATATTTTTATTCTCTTGTATTTTTTATATTTGTCTTCATAATTAAAAAAAGGTTTTTTGTTTCTTTGTGCCATTCTGCTTTGGTAATATCTTTGAAATCTGTTGTTTTTTTTCTAGGATGGTCATTCCAAACCTGTGCTTGCAGAAGTGGCAATCATGCGTAGGTTGATGAAAGCTCCGCAATGTCCGAACATCATCAGATTACATGACTGGATTGAGAATGAGAGCGAATGCATTCTCATTTTGGAGTACCCAGAGTCATGCCAGACTTTGGGTCGTTACATCAAAAAGACATCGGACATGGATGAAAACAAAGCACGCCGGTTAATGCGT[C/T]AGTTGGTCCAAGCTGTCAAGTTCTGCGTTGAACGTGGAGTTTTCCATGGTGATATACACTCGCAGAACATCCTGGTGACTACACCCCAGTTAGAGCTCAAATTGATCGACTTCGGTTGTGCTTGGCCAGTCACCCGTAGGCCTTTCTTCAGCTATAATTATCAAGGTGAGTGGGCATTTTGTGTCAAGTGTCTTTGATCACAGTATTGCCTGATGAAATGACTGAATTCTGAAAATGTCTCTCTTACAGGAGCTAGACGTTGCACGCCAGCTGAGGTTTTAATGCATCGCAAATTCTCCCCTACCATGGCAAATGTCTGGGCGATAGGCATCGTGCTGTTTGAAATATTGCATAGACGGTTGCCCTTTTACGACAGACCAACGATAATGGGTGGAGGCCTTCGCATGGACCCCACCTTATCTTCAGGTAAGCACAATCTTAGCCTCAGTGACAGAATAAAATATGTAAAAAGGATTAAATTTAAGGGTTACAGTAGATAT
Associated Phenotype:
Not determined