Busch Lab

ZMP

NRP1 (2 of 3)

Ensembl ID:
ENSDARG00000093598
Description:
neuropilin 1 [Source:HGNC Symbol;Acc:8004]
Human Orthologue:
NRP1
Human Description:
neuropilin 1 [Source:HGNC Symbol;Acc:8004]
Mouse Orthologue:
Nrp1
Mouse Description:
neuropilin 1 Gene [Source:MGI Symbol;Acc:MGI:106206]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa32 Missense Confirmed mutation in F2 line Not yet available
sa24430 Nonsense Available for shipment Available now
sa1485 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106642 Missense 5 190 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1261448)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1252764
GRCz11 24 1248808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAGATGAATGTGTGTTCATGTGTGTGTTTCTCTCTCTGCAGATATGAC[T/A]ATGTGGAAGTGAGAGACGGCGTGGATGAGAACGGGCAGCTGGTGGGCAAA
Long Flanking Sequence:
TATGACAAACTCAGTACTGGCAAACTTGCAAACTTTGTGAAAAGGGTCAATTGTATTATGAAGTTGTTATTATTATTATTATGTAATATATTTTTATTTATATTGATCTTGCCATAAGTAGCCAAAATATTGCTTATGTGGCAATAAATAAACAAACCAAATATCATTTACTGTTCATCTGAATCAGCTGAGCTGCTGTGACAGTGTTAGATGTTCTGTTTGTGTGTGTTTCTCTCTCTGCAGATATGACTATGCATGTGCAAGTACAGTAAAAGTATCTGTTGTAAGCAATACTTAAATTATGAGTGAAGTTAGGCCTTCTAAAAGTACTCAAAAGTAGTAAATATTACACTTTATTTTAAACACTGCAGATTAAAAATGTGCTTTACATTAGTGCCAATTTGTTTTATGGACATTTTTGAGTGTTATTGTGTTAGTTATTGTTAGATGTTCAGATGAATGTGTGTTCATGTGTGTGTTTCTCTCTCTGCAGATATGAC[T/A]ATGTGGAAGTGAGAGACGGCGTGGATGAGAACGGGCAGCTGGTGGGCAAATATTGTGGAAAGATCGCTCCATCTCCGGTGGTCTCGTCGGGAAACCAGCTCTTCATCAAGTTTGTGTCCGACTACGAGACTCACGGTGCCGGATTCTCCATCCGCTATGAGATCTTCAAAACGGGTAAGGAAAAAACATTTACAAACATCCACTTTATGAGGCCAAGGAGCCCTATTTAAGTCTGTCATGAGCCGGAAGCTGCTGTTGGCCCCTAATAGTATCACTCAAAACAGCATGGTCCTTTAGAATTGTCCTAACCCTAACAGCGCCCCTGCTTGCAGAGAGTAGGGTTTACAGCTAGTGGTTAAACTAGGTATTGCAGTCCAAATTCAAATCATTGTGTGTATATTTTTCACATGGCACCCTCTGATGATGACTCGACATACAAACAGGTTGCCAGATTGACAACATCAACATTTTGCAAGCATGCCTGATTATCGAGACCTACC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30024
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106642 Nonsense 17 190 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1261412)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1252728
GRCz11 24 1248772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCAGATATGACTATGTGGAAGTGAGAGACGGCGTGGATGAGAACGGG[C/T]AGCTGGTGGGCAAATATTGTGGAAAGATCGCTCCATCTCCGGTGGTCTCG
Long Flanking Sequence:
GTGAAAAGGGTCAATTGTATTATGAAGTTGTTATTATTATTATTATGTAATATATTTTTATTTATATTGATCTTGCCATAAGTAGCCAAAATATTGCTTATGTGGCAATAAATAAACAAACCAAATATCATTTACTGTTCATCTGAATCAGCTGAGCTGCTGTGACAGTGTTAGATGTTCTGTTTGTGTGTGTTTCTCTCTCTGCAGATATGACTATGCATGTGCAAGTACAGTAAAAGTATCTGTTGTAAGCAATACTTAAATTATGAGTGAAGTTAGGCCTTCTAAAAGTACTCAAAAGTAGTAAATATTACACTTTATTTTAAACACTGCAGATTAAAAATGTGCTTTACATTAGTGCCAATTTGTTTTATGGACATTTTTGAGTGTTATTGTGTTAGTTATTGTTAGATGTTCAGATGAATGTGTGTTCATGTGTGTGTTTCTCTCTCTGCAGATATGACTATGTGGAAGTGAGAGACGGCGTGGATGAGAACGGG[C/T]AGCTGGTGGGCAAATATTGTGGAAAGATCGCTCCATCTCCGGTGGTCTCGTCGGGAAACCAGCTCTTCATCAAGTTTGTGTCCGACTACGAGACTCACGGTGCCGGATTCTCCATCCGCTATGAGATCTTCAAAACGGGTAAGGAAAAAACATTTACAAACATCCACTTTATGAGGCCAAGGAGCCCTATTTAAGTCTGTCATGAGCCGGAAGCTGCTGTTGGCCCCTAATAGTATCACTCAAAACAGCATGGTCCTTTAGAATTGTCCTAACCCTAACAGCGCCCCTGCTTGCAGAGAGTAGGGTTTACAGCTAGTGGTTAAACTAGGTATTGCAGTCCAAATTCAAATCATTGTGTGTATATTTTTCACATGGCACCCTCTGATGATGACTCGACATACAAACAGGTTGCCAGATTGACAACATCAACATTTTGCAAGCATGCCTGATTATCGAGACCTACCTAGTGGTTGAACCCGGTATTGCAGTCTAAATTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24430
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106642 Nonsense 46 190 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1261323)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1252639
GRCz11 24 1248683
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGGTGGTCTCGTCGGGAAACCAGCTCTTCATCAAGTTTGTGTCCGACTA[C/A]GAGACTCACGGTGCCGGATTCTCCATCCGCTATGAGATCTTCAAAACGGG
Long Flanking Sequence:
AATATTGCTTATGTGGCAATAAATAAACAAACCAAATATCATTTACTGTTCATCTGAATCAGCTGAGCTGCTGTGACAGTGTTAGATGTTCTGTTTGTGTGTGTTTCTCTCTCTGCAGATATGACTATGCATGTGCAAGTACAGTAAAAGTATCTGTTGTAAGCAATACTTAAATTATGAGTGAAGTTAGGCCTTCTAAAAGTACTCAAAAGTAGTAAATATTACACTTTATTTTAAACACTGCAGATTAAAAATGTGCTTTACATTAGTGCCAATTTGTTTTATGGACATTTTTGAGTGTTATTGTGTTAGTTATTGTTAGATGTTCAGATGAATGTGTGTTCATGTGTGTGTTTCTCTCTCTGCAGATATGACTATGTGGAAGTGAGAGACGGCGTGGATGAGAACGGGCAGCTGGTGGGCAAATATTGTGGAAAGATCGCTCCATCTCCGGTGGTCTCGTCGGGAAACCAGCTCTTCATCAAGTTTGTGTCCGACTA[C/A]GAGACTCACGGTGCCGGATTCTCCATCCGCTATGAGATCTTCAAAACGGGTAAGGAAAAAACATTTACAAACATCCACTTTATGAGGCCAAGGAGCCCTATTTAAGTCTGTCATGAGCCGGAAGCTGCTGTTGGCCCCTAATAGTATCACTCAAAACAGCATGGTCCTTTAGAATTGTCCTAACCCTAACAGCGCCCCTGCTTGCAGAGAGTAGGGTTTACAGCTAGTGGTTAAACTAGGTATTGCAGTCCAAATTCAAATCATTGTGTGTATATTTTTCACATGGCACCCTCTGATGATGACTCGACATACAAACAGGTTGCCAGATTGACAACATCAACATTTTGCAAGCATGCCTGATTATCGAGACCTACCTAGTGGTTGAACCCGGTATTGCAGTCTAAATTCAAAACATTGTAGGGGTTTTTGTTCACCAAGCCCTTCTGATGACGATAGCACTAAACATATGCAGGTTGCCAGATTGATGACACAAAAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1485
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106642 Nonsense 127 190 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1248914)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1240230
GRCz11 24 1236274
KASP Assay ID:
554-1410.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGAGCTGGAGCCAGACACGCAGCCGCCCGCCGGAGTCTTCTGCCGATA[C/A]GACCGCCTGGAGATTTGGGACGGATTCCCTGGAGGTGAGTCAATGGAGAA
Long Flanking Sequence:
CAAGCACCAGTCACTTCATCGAGTGCATATAAAACATTTAATAAGATCAGCCTCATATGCGCTTGTGCTTTCTTTTTGGGTTCATTTTCATCATTAGCCCACAACACACCCCAAAAAATCAAGCATCAGCCATATTCCGAGCAGGGTGGGCCTCCACCACGGCCCATAAACCCTGCAATCATCCAGCAAAACAACACAGACCACCGTGTTTCTGCTTCAGTGTTTGTTATTATTCCCCTTTACTCCGTCTGCCCGAGTGAACAAACAAAAAAGCTCACTTTTTCCTTCCTCTCTGTGTCCACCGTAGGTCCAGAATGTTCCAGGAACTTCACCTCCAGCAGCGGAGTCATCAAGTCGCCCGGATTTCCAGAGAAATACCCCAATAATTTGGACTGCACGTTCATGATCTTTGCTCCTAAGATGTCAGAAATCGTTTTAGAGTTCGAGAGTTTTGAGCTGGAGCCAGACACGCAGCCGCCCGCCGGAGTCTTCTGCCGATA[C/A]GACCGCCTGGAGATTTGGGACGGATTCCCTGGAGGTGAGTCAATGGAGAAAATCTGAATACTTAAACTGAAAAAAATAATCATTTAGCAGATGATTTTTGCACATTAATTCTAAAAGGCGCACACTTTAACAGAATAGCAGCCATATAGTTGGATCATGTTCATATAGAGACGTGCAGAAACACAAACATATATGACAACAAGAATCTGGTAACTATTTAGTTTAACAGTGCAATGTGTTGGGCTGACGACTAGTGGTTGAACTAAGTATTGCAGTCCAAGTTCGAAATATTGTCTGTGGTAGTATTTGAGACTTTTTCCTGTTAGTATGGGTTAGTCTCGGGCAGATTGGGGTGAAAGACTCTGGAATGTAGACTGTTGTCATAACACCTAAAATCTTCCATTCCTCAAGGTAATTGCAGTTTATATTAGTGTGTATTTGAGCTGCATAAACACACCCAACAGCCCAACAGGAAGATTCCAGCTCAAAGCGGGGAAGGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461