Busch Lab

ZMP

si:dkey-14d8.20

Ensembl ID:
ENSDARG00000093586
ZFIN ID:
ZDB-GENE-041210-146
Description:
Novel protein similar to vertebrate scavenger receptor protein [Source:UniProtKB/TrEMBL;Acc:Q5RHW7]
Human Orthologues:
AC008735.1, CD5L
Human Descriptions:
CD5 molecule-like [Source:HGNC Symbol;Acc:1690]
Scavenger receptor cysteine-rich domain-containing protein LOC284297 [Source:UniProtKB/Swiss-Prot;Ac
Mouse Orthologues:
A430110N23Rik, Cd5l
Mouse Descriptions:
CD5 antigen-like Gene [Source:MGI Symbol;Acc:MGI:1334419]
RIKEN cDNA A430110N23 gene Gene [Source:MGI Symbol;Acc:MGI:3606211]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa6047 Nonsense Mutation detected in F1 DNA Not yet available
sa13640 Nonsense Available for shipment Available now
sa14156 Nonsense Available for shipment Available now
sa13941 Nonsense Available for shipment Available now
sa15797 Nonsense Available for shipment Available now
sa10315 Essential Splice Site Available for shipment Available now
sa33373 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6047
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 525 1140 5 11
Genomic Location (Zv9):
Chromosome 4 (position 5271685)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5389866
GRCz11 4 5398436
KASP Assay ID:
554-3721.1 (used for ordering genotyping assays)
KASP Sequence:
TCACTTAAGCCGAAAASTACTGACCATTCGAAGGACGCTGGGGTCATCTG[C/A]GACTGTAAGTCWTTTATATTTTATGCAAGTAAAAAGAGAAATGAAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13640
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 538 1140 6 11
ENSDART00000135122 Nonsense 538 1140 6 11
Genomic Location (Zv9):
Chromosome 4 (position 5272197)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5390378
GRCz11 4 5398948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTAATGTGGATTCAGCTCCTGTCAGGCTCATTAATGGAAATAACTCGTG[T/A]TCTGGAYGAGYGGAGGTTTTCTATAGTGGTCAGTGGGGAACAGTGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14156
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 538 1140 6 11
ENSDART00000135122 Nonsense 538 1140 6 11
Genomic Location (Zv9):
Chromosome 4 (position 5272197)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5390378
GRCz11 4 5398948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTAATGTGGATTCAGCTCCTGTCAGGCTCATTAATGGAAATAACTCGTG[T/A]TCTGGAYGAGYGGAGGTTTTCTATAGTGGTCAGTGGGGAACAGTGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13941
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 541 1140 6 11
Genomic Location (Zv9):
Chromosome 4 (position 5272204)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5390385
GRCz11 4 5398955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGATTCAGCTCCTGTCAGGCTCATTAATGGAAATAACTCGTGWTCTGGA[C/T]GAGYGGAGGTTTTCTATAGTGGTCAGTGGGGAACAGTGTGTGGTGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15797
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 855 1140 9 11
Genomic Location (Zv9):
Chromosome 4 (position 5283418)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5401599
GRCz11 4 5410169
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCGGCATCAACTCTTGTTCTGGACGAGTGGAGGTTTTCCATAACGGCT[T/G]ATGGGGAACAGTGTGTGATGATTACTGGGGTCTGACAAACGCTGCAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10315
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Essential Splice Site 1039 1140 11 11
Genomic Location (Zv9):
Chromosome 4 (position 5288456)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5406637
GRCz11 4 5415207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTGTTAATCTCAGTTTTTTGTCTTTGTTTTTTCATTGGTGTCATCATCA[G/A]TCCCTGTCAGGCTGAYGGGTGGAMGAGACGCATGTTCTGGACTTGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33373
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 1123 1140 11 11
Genomic Location (Zv9):
Chromosome 4 (position 5288708)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5406889
GRCz11 4 5415459
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTCGACTGTGTTGGCAGTGAGTCTTCCCTAATACAATGTAGCTTAGAT[C/T]GATGGCTGCCAAATCACGTCAACCATCTGAATGATGCTGGAGTCGTCTGC
Associated Phenotype:
Not determined