Busch Lab

ZMP

si:dkey-80c24.4

Ensembl ID:
ENSDARG00000093579
ZFIN ID:
ZDB-GENE-061207-72
Description:
Putative novel protein [Source:UniProtKB/TrEMBL;Acc:A2CEU4]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24629 Essential Splice Site Available for shipment Available now
sa44257 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24629
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146880 Essential Splice Site 147 218 2 4
Genomic Location (Zv9):
Chromosome 25 (position 16516231)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16062775
GRCz11 25 16159175
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGCCGTTGAGTGTTCCGGGCCCCTCCAGGATCAAGCAAACAGCAGAT[G/A]TGCCGAATGCAGATCGGGCCCGTCCTGAGTCCTCAACGGCCCTCACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44257
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146880 Essential Splice Site 148 218 3 4
Genomic Location (Zv9):
Chromosome 25 (position 16515965)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16062509
GRCz11 25 16158909
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTTCCGGGCCCCTCCAGGATCAAGCAATCAGCAGAAGTGCAGAATGC[A/G]GATCCAGCCCGTCCTGAGTCCTCAACGGCCCTCACAGGTCATGTTGACAC
Associated Phenotype:
Not determined