Busch Lab

ZMP

zgc:193706

Ensembl ID:
ENSDARG00000093568
ZFIN ID:
ZDB-GENE-081022-33
Description:
chemokine CCL-C25y-like [Source:RefSeq peptide;Acc:NP_001122280]
Human Orthologues:
CCL14, CCL18, CCL3, CCL3L1, CCL4, CCL4L1, CCL4L2, CCL5
Human Descriptions:
chemokine (C-C motif) ligand 14 [Source:HGNC Symbol;Acc:10612]
chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated) [Source:HGNC Symbol;Acc:10616]
chemokine (C-C motif) ligand 3 [Source:HGNC Symbol;Acc:10627]
chemokine (C-C motif) ligand 3-like 1 [Source:HGNC Symbol;Acc:10628]
chemokine (C-C motif) ligand 4 [Source:HGNC Symbol;Acc:10630]
chemokine (C-C motif) ligand 4-like 1 [Source:HGNC Symbol;Acc:10631]
chemokine (C-C motif) ligand 4-like 2 [Source:HGNC Symbol;Acc:24066]
chemokine (C-C motif) ligand 5 [Source:HGNC Symbol;Acc:10632]
Mouse Orthologues:
Ccl3, Ccl4, Ccl5
Mouse Descriptions:
chemokine (C-C motif) ligand 3 Gene [Source:MGI Symbol;Acc:MGI:98260]
chemokine (C-C motif) ligand 4 Gene [Source:MGI Symbol;Acc:MGI:98261]
chemokine (C-C motif) ligand 5 Gene [Source:MGI Symbol;Acc:MGI:98262]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8055
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142559 Essential Splice Site 24 98 1 3
Genomic Location (Zv9):
Chromosome 25 (position 12900150)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 12954309
GRCz11 25 13050814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTATCTGCTGTTRTGGTGCTGCTGTGTGCCGTCAGCCTCAGTCAAGG[T/A]AAGATGAAGAAAGAGTAGTAAATAATATATATNNTRAATGATTTATTTGAAG
Long Flanking Sequence:
GGCACGAGGGAGTAAGAATTAAATGATGAAATTCAAATGTCTGCATCTAATTTCCCCTTCACAAAGGGCCGCAGTGTTCAGCACTCTAGTGTTTTTCTTTTTTCTGAAACGAAAAGAGGAAGTGAAAGGTTTGCAATCAGGACCGTCCCCTACAGTAGGCTATCAGAACAAGTTTAAATGTGAACAGTGAAGGTCAGAGCACGTGTTTGTGTGTGAGTGTGACGACGAGAGACTGATGGAGTTTCTCTCTGCGTGGGTGAATTCAAAGCAAAATTTCCCTCTTCAAATTCCACCCCGAATCACGGATCTTCCCTTCTCTGAGGAGTTGTATAAAAGAGGACAGGACAAACCATGAGACACACATTAGATCAAGCTTGAGGAATCATTTCTGGAAGATTCTTAGGTCATCATCTAGTAGAAAGTGCTAAAATGAGCACCTCTCGCTTTGTGTTTTTATCTGCTGTTGTGGTGCTGCTGTGTGCCGTCAGCCTCAGTCAAGG[T/A]AAGATGAAGAAAGAGTAGTAAATAATATATATTGAATGATTTATTTGAAGAAAACTATCTTATATTATATAAATTATGAATATTATATATTTTCTAAAAAATATATTAATTTGTATTTTTGTAATTTTGCTTTTTTTTGTAATTGTTTTTTTTATATAATATAAAACATAATATAACTTGTATAATATAAAGTACTTTATATATTTGAACTAATAGTATTTCATAAGTAATATAGTAAATTCTGTTATTAATGAATATGTATTGTGAACCACATTGATATTTTCTATAAGTTTTTTTGCAACTAACAATAACTAATGTAGTATAAGTAATAGAAAGCAATAAGTAACTAACAATAACTTGATTGTGTTTTCTTTATTCTAGGTATGCGCATTGGACCAAAGAGATGCTGTTTCCAGTATGCGGAACGTCAAGTGCCTTTCAAACAAGTAATGGAATACAGCATGACAAGCCAGCAGTGCCCCAAAGAAGCCGTCCTGTAC
Associated Phenotype:
Not determined