Busch Lab

ZMP

si:ch211-225b11.4

Ensembl ID:
ENSDARG00000093563
ZFIN ID:
ZDB-GENE-060526-114
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BGW1]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa8906 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8906
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137603 Nonsense 224 344 4 5
Genomic Location (Zv9):
Chromosome 5 (position 22670674)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20383546
GRCz11 5 20887346
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCRAATGTGTTTGCAGAGCCATCTGTGATCTCAGAGTGTCTGSTGCCATA[C/A]CTTTTGCGTCTGGTTAAACATTACCCACAATCCTCCAGCCTCGCAGAGAA
Associated Phenotype:
Not determined