Busch Lab

ZMP

si:ch211-9n13.3

Ensembl ID:
ENSDARG00000093432
ZFIN ID:
ZDB-GENE-060503-800
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LVP3]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa3028 Essential Splice Site F2 line generated Not yet available
sa3015 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4075
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132046 Essential Splice Site None 137 1 2
Genomic Location (Zv9):
Chromosome 19 (position 35822931)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 34687451
GRCz11 19 34274571
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTGAAACGCTGCCAGCGTGAATGCTGRTGCCAGACAATACGAGGAAAG[G/A]KAACTTTGTCCTCATTTACTGTTTCTTTATGATTTGACAAGTCACTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3028
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132046 Essential Splice Site None 137 1 2
Genomic Location (Zv9):
Chromosome 19 (position 35822932)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 34687452
GRCz11 19 34274572
KASP Assay ID:
554-3381.1 (used for ordering genotyping assays)
KASP Sequence:
TCTGAAACGCTGCCAGCGTGAATGCTGRTGCCAGACAATACGAGGAAAGR[T/G]AACTTTGTCCTCATTTACTGTTTCTTTATGATTTGACAAGTCACTGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3015
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132046 Nonsense 71 137 2 2
Genomic Location (Zv9):
Chromosome 19 (position 35827334)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 34691854
GRCz11 19 34278974
KASP Assay ID:
554-2829.1 (used for ordering genotyping assays)
KASP Sequence:
TTTMTCCAAACTGTGACGCTGACAGAAGTGTTTTGTGGAAAGAAGAGGTA[T/A]AAATGCTCRGGCTGCCTGCGCTACTATGAGGATCTGGAGTGTCTGATGGC
Associated Phenotype:
Not determined