Busch Lab

ZMP

si:dkey-225e17.4

Ensembl ID:
ENSDARG00000093409
ZFIN ID:
ZDB-GENE-081104-379
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A4I3]
Human Orthologue:
KIAA1161
Human Description:
KIAA1161 [Source:HGNC Symbol;Acc:19918]
Mouse Orthologue:
AI464131
Mouse Description:
expressed sequence AI464131 Gene [Source:MGI Symbol;Acc:MGI:2140300]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa17442 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17442
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136170 Nonsense 28 214 1 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 24468533)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23647646
GRCz11 25 23745194
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATCCCAGAGGTGACATGGGACACGGGCTTGAAAGAGATGAACGAGACCT[G/A]GAAGGGCGCAATTGCTTGCTTGGGAGTCGCTGTGTTTTTTGTCATGACAA
Associated Phenotype:
Not determined