Busch Lab

ZMP

scn4bb

Ensembl ID:
ENSDARG00000093246
ZFIN ID:
ZDB-GENE-031116-71
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BGB6]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa11040 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11040
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125857 None None 100 2 2
ENSDART00000141233 Essential Splice Site 74 98 None 2
Genomic Location (Zv9):
Chromosome 5 (position 39534665)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37334055
GRCz11 5 37934208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGAGTTCTRAAATTTTAYCTTCACCGCTGAGCAGATTCTTGATCTTCC[A/G]GRCCTCTGAGACCTGGACAGGCCTTTGACAGGAGGAGTCTTATGCTTGAT
Associated Phenotype:
Not determined