Busch Lab

ZMP

ddx1

Ensembl ID:
ENSDARG00000093213
ZFIN ID:
ZDB-GENE-041001-215
Description:
Novel protein similar to vertebrate DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 (DDX1) [Source:UniProtK
Human Orthologue:
DDX1
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 [Source:HGNC Symbol;Acc:2734]
Mouse Orthologue:
Ddx1
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:2144727]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45708 Nonsense Mutation detected in F1 DNA Not yet available
sa16316 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa45708
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144780 Nonsense 9 358 1 14

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33214248)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33272488
GRCz11 20 33175367
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATCTTATTGTTTTGCCTTACAGAAATGGGAGTGATGCCAGAAATTGCA[C/T]AGGCGGTGGAAGAAATGGACTGGCTGTGAGTTCTAATGATCTTACATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16316
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144780 Essential Splice Site 203 358 None 14

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33217350)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33275590
GRCz11 20 33178469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGATGCTACATAGATCTGGAAAAAGGCCATGTGTCATTCTCCAAAAATGG[T/C]AGGGTTCTGWTTAGTTTTAGTAAATAAAACTTTTTCTTTTYAAAATTCAG
Associated Phenotype:
Not determined