Busch Lab

ZMP

LOC100331428

Ensembl ID:
ENSDARG00000093198
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25697
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143793 Nonsense 456 1606 13 42
Genomic Location (Zv9):
Chromosome 1 (position 56564935)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55348972
GRCz11 1 56025563
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATTTCCAGATTTTGAGTAGAGGTCAGATTGTGCAAGCAAACAGATTT[A/T]AGCGGAGAGGACAAACTCTGGTGTCTCTGTCTCTACCTGTGACCAAAGAC
Associated Phenotype:
Not determined