Busch Lab

ZMP

PKHD1L1 (1 of 3)

Ensembl ID:
ENSDARG00000093191
Description:
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1 [Source:HGNC Symbol;Acc:20313]
Human Orthologue:
PKHD1L1
Human Description:
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1 [Source:HGNC Symbol;Acc:20313]
Mouse Orthologue:
Pkhd1l1
Mouse Description:
polycystic kidney and hepatic disease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183153]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa29197 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18556 Essential Splice Site Available for shipment Available now
sa987 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29196
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135830 Essential Splice Site 482 1019 14 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23346765)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23276180
GRCz11 19 22860503
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTACAGCACCCAGAGGTCCGCTGTCATGCGCTTAGAGAAGGGAAAACC[G/A]TAAGTTTTAAATGGTGCTTAAATGTGTGATGTGTGTCCAATTGGTGTGTA
Long Flanking Sequence:
ACCGAATGGACTGATTCAAAGGTTGCATAGGAAGGGCAATGGTCAACGCATAGCTTTAATAGAAAGAAAAAGCATAAAAATATAAAGCGAAAGCATAATTCTCTTCAACAGCTTTTGCAATTATATCACATTTAAGATTTCCCTGTTTGATGCTACTTTCACTTTTCATAGAACGATTAGAAATACTGAAAAAAAATTTAACAGGATAATAGCAGGATAGAATTGTAAAATACGGGAGAATCATAACATAACCGATATTTTTATGGTTTAGTTAAATTTGCTAATGCTAATGTCCCCTCTAAACATCACTTTTGGCCTCTTCGTTATGCTATATTTGTATAAAATGCTAATGATTTCAATTTTATCCAACTTCACCTTGTTTTTTTTTTCTTCATCATGTGCTTCCAGGTCAAGATTGCATATCAGCCTTATTATACAAACAGCTTCTTCACCTACAGCACCCAGAGGTCCGCTGTCATGCGCTTAGAGAAGGGAAAACC[G/A]TAAGTTTTAAATGGTGCTTAAATGTGTGATGTGTGTCCAATTGGTGTGTAAATAACTACACTGTAAAAAGTAAAGGTGCTTCAAATACCCTGTTGAGTACTCAACGTCTAAATGTACTTTAAATGCCTCAAAGCTCTTTCTCTCAAAAGGGTTTCTGTGAGGAAACACTGACAGTCTTTGCAGTACTTGTAGGACCATTTTGCTGTAATTAGGATCCTTCAAGCACTTTTTGTCAATACTGAGGGTCTGGAGTCACTGTTTCCTTACACTAAGACCCCAGAGCACTTTGAAAGATATTAGAGGAACTCATATTCCAATAAAGAGTATACTGGAAGATCTGTAAACTTATATAATGGTTCCTGGTGGATCTGTCTTCTAAAAACTAGCAGTTAGAGGAACCAATAGTTTTTATGACATTTAAATAGGACACTTGTAGAGACCAAAAAATGATATACATGTCTATTTAGTTATTTGTGAAATTAGAATGATATGAATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29197
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135830 Essential Splice Site 482 1019 None 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23346766)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23276181
GRCz11 19 22860504
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTACAGCACCCAGAGGTCCGCTGTCATGCGCTTAGAGAAGGGAAAACCG[T/G]AAGTTTTAAATGGTGCTTAAATGTGTGATGTGTGTCCAATTGGTGTGTAA
Long Flanking Sequence:
CCGAATGGACTGATTCAAAGGTTGCATAGGAAGGGCAATGGTCAACGCATAGCTTTAATAGAAAGAAAAAGCATAAAAATATAAAGCGAAAGCATAATTCTCTTCAACAGCTTTTGCAATTATATCACATTTAAGATTTCCCTGTTTGATGCTACTTTCACTTTTCATAGAACGATTAGAAATACTGAAAAAAAATTTAACAGGATAATAGCAGGATAGAATTGTAAAATACGGGAGAATCATAACATAACCGATATTTTTATGGTTTAGTTAAATTTGCTAATGCTAATGTCCCCTCTAAACATCACTTTTGGCCTCTTCGTTATGCTATATTTGTATAAAATGCTAATGATTTCAATTTTATCCAACTTCACCTTGTTTTTTTTTTCTTCATCATGTGCTTCCAGGTCAAGATTGCATATCAGCCTTATTATACAAACAGCTTCTTCACCTACAGCACCCAGAGGTCCGCTGTCATGCGCTTAGAGAAGGGAAAACCG[T/G]AAGTTTTAAATGGTGCTTAAATGTGTGATGTGTGTCCAATTGGTGTGTAAATAACTACACTGTAAAAAGTAAAGGTGCTTCAAATACCCTGTTGAGTACTCAACGTCTAAATGTACTTTAAATGCCTCAAAGCTCTTTCTCTCAAAAGGGTTTCTGTGAGGAAACACTGACAGTCTTTGCAGTACTTGTAGGACCATTTTGCTGTAATTAGGATCCTTCAAGCACTTTTTGTCAATACTGAGGGTCTGGAGTCACTGTTTCCTTACACTAAGACCCCAGAGCACTTTGAAAGATATTAGAGGAACTCATATTCCAATAAAGAGTATACTGGAAGATCTGTAAACTTATATAATGGTTCCTGGTGGATCTGTCTTCTAAAAACTAGCAGTTAGAGGAACCAATAGTTTTTATGACATTTAAATAGGACACTTGTAGAGACCAAAAAATGATATACATGTCTATTTAGTTATTTGTGAAATTAGAATGATATGAATTATTAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29198
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135830 Nonsense 483 1019 15 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23348111)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23277526
GRCz11 19 22861849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGGATCTAAACATTTTCTCTGTATAATTCTTTCAATGTGCTGCAGGTA[C/A]TACATCGAAGTTCTAATGCAGGAATATGCAGTAGTAGCATCAGTAGATGT
Long Flanking Sequence:
TCGCAACATGTGCCATTTGAGAGCCAACTTACTTGTGCCATTCCAACACAATCTCACAGCAATTTATAACTTTTTGATTTAGTGGCTAATTCATATGAATTCGTATGATCTCATACATACAGTTTGGTATGATTTGCTTATCCCCCAATGGTGGTTGGGTTTAGGGGCGGGGTGTGGTGCCACGCCTCCTTTTTAAGATAATACATTTTCGTATGTTCAAATTTGTACAAATTAGCTACTAAATTGACAAAATGTAATATAGTTACATTTCCTTGTGAGATAAGACTGGCTATTCCGACGTGTGTTCTCAGAAAACAGTACAGTGTTTAAACCAAGACATTAACTGCAGTGCCATGTGATCGATAAAACAAATTGCAAATTTACAAACATACTGAAGACAATGGAGTTTTTCTTGTTAAAATAAACATAAAAGGTCTTGTTTTCTCCAATCTTGGATCTAAACATTTTCTCTGTATAATTCTTTCAATGTGCTGCAGGTA[C/A]TACATCGAAGTTCTAATGCAGGAATATGCAGTAGTAGCATCAGTAGATGTGGGCTTTTTCAAAGAGGTCAGCCCTTTCACGGCCCAGCAGACAATAGAGTCTGTTAATGAGAAACAGCAGATCAACGCATACTACTCTATACTACCTGAAAAACAGGTAAGTGAACTCACTTTAGGCAGAGTTCAAAGATTATCTAAAGATAAGATGGAAGGAAGCCTTAGAAAAATCTGCAAACTTAATAGGAGAAAAGTTTTTCTGTCTGTACTGTATGTGTGTGTGTGTTTTAAACTCTATTAATACTGCTTTAGGTGATACGTTTTGATGGATGGACACCAGTAACTGCTGTGAATGAGGTTCAAACTTTAAGAATCAGCAGTGACTGTTTTTCTCAGGGCACATGTGAAAACACATACTACTCACTAGGATATGGAAATCTTACAACAGGTGTAATACAATACAATGGTTCTAAGAATGTGTTTAAAGGAGCCAAATATTCGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4810
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135830 Splice Site, Nonsense 535 1019 15 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23348265)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23277680
GRCz11 19 22862003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAATGAGAAACAGCAGATCAACGCATACTACTCTATACTACCTGAAAAA[C/T]AGGTAAGTGAACTCACTTTAGGCAGAGTTCAAAGATTATCTAAAGATAAG
Long Flanking Sequence:
TTGGGTTTAGGGGCGGGGTGTGGTGCCACGCCTCCTTTTTAAGATAATACATTTTCGTATGTTCAAATTTGTACAAATTAGCTACTAAATTGACAAAATGTAATATAGTTACATTTCCTTGTGAGATAAGACTGGCTATTCCGACGTGTGTTCTCAGAAAACAGTACAGTGTTTAAACCAAGACATTAACTGCAGTGCCATGTGATCGATAAAACAAATTGCAAATTTACAAACATACTGAAGACAATGGAGTTTTTCTTGTTAAAATAAACATAAAAGGTCTTGTTTTCTCCAATCTTGGATCTAAACATTTTCTCTGTATAATTCTTTCAATGTGCTGCAGGTACTACATCGAAGTTCTAATGCAGGAATATGCAGTAGTAGCATCAGTAGATGTGGGCTTTTTCAAAGAGGTCAGCCCTTTCACGGCCCAGCAGACAATAGAGTCTGTTAATGAGAAACAGCAGATCAACGCATACTACTCTATACTACCTGAAAAA[C/T]AGGTAAGTGAACTCACTTTAGGCAGAGTTCAAAGATTATCTAAAGATAAGATGGAAGGAAGCCTTAGAAAAATCTGCAAACTTAATAGGAGAAAAGTTTTTCTGTCTGTACTGTATGTGTGTGTGTGTTTTAAACTCTATTAATACTGCTTTAGGTGATACGTTTTGATGGATGGACACCAGTAACTGCTGTGAATGAGGTTCAAACTTTAAGAATCAGCAGTGACTGTTTTTCTCAGGGCACATGTGAAAACACATACTACTCACTAGGATATGGAAATCTTACAACAGGTGTAATACAATACAATGGTTCTAAGAATGTGTTTAAAGGAGCCAAATATTCGTTTTTTAATTCACTTCTAAATTTTTACATGTTTGTGATACTTTTATTTGCATGTGTTGTAATGTTTACTGTAATTAATTACTGTGCGTGTTGTAGGACCGATCCCTGTCAGTGCTTCAGCAATGGATTTGCAGAATGCTCTGAATGACTTGTGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18556
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135830 Essential Splice Site 535 1019 None 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23348269)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23277684
GRCz11 19 22862007
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGAAACAGCAGATCAACGCATACTACTCTATACTACCTGAAAAAYAGG[T/C]AAGTGAACTCACTTTAGGCAGAGTTCAAAGATTATCTAAAGATAAGATGG
Long Flanking Sequence:
GTTTAGGGGCGGGGTGTGGTGCCACGCCTCCTTTTTAAGATAATACATTTTCGTATGTTCAAATTTGTACAAATTAGCTACTAAATTGACAAAATGTAATATAGTTACATTTCCTTGTGAGATAAGACTGGCTATTCCGACGTGTGTTCTCAGAAAACAGTACAGTGTTTAAACCAAGACATTAACTGCAGTGCCATGTGATCGATAAAACAAATTGCAAATTTACAAACATACTGAAGACAATGGAGTTTTTCTTGTTAAAATAAACATAAAAGGTCTTGTTTTCTCCAATCTTGGATCTAAACATTTTCTCTGTATAATTCTTTCAATGTGCTGCAGGTACTACATCGAAGTTCTAATGCAGGAATATGCAGTAGTAGCATCAGTAGATGTGGGCTTTTTCAAAGAGGTCAGCCCTTTCACGGCCCAGCAGACAATAGAGTCTGTTAATGAGAAACAGCAGATCAACGCATACTACTCTATACTACCTGAAAAACAGG[T/C]AAGTGAACTCACTTTAGGCAGAGTTCAAAGATTATCTAAAGATAAGATGGAAGGAAGCCTTAGAAAAATCTGCAAACTTAATAGGAGAAAAGTTTTTCTGTCTGTACTGTATGTGTGTGTGTGTTTTAAACTCTATTAATACTGCTTTAGGTGATACGTTTTGATGGATGGACACCAGTAACTGCTGTGAATGAGGTTCAAACTTTAAGAATCAGCAGTGACTGTTTTTCTCAGGGCACATGTGAAAACACATACTACTCACTAGGATATGGAAATCTTACAACAGGTGTAATACAATACAATGGTTCTAAGAATGTGTTTAAAGGAGCCAAATATTCGTTTTTTAATTCACTTCTAAATTTTTACATGTTTGTGATACTTTTATTTGCATGTGTTGTAATGTTTACTGTAATTAATTACTGTGCGTGTTGTAGGACCGATCCCTGTCAGTGCTTCAGCAATGGATTTGCAGAATGCTCTGAATGACTTGTGGACGATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa987
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135830 Nonsense 709 1019 19 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23349482)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23278897
GRCz11 19 22863220
KASP Assay ID:
554-0891.1 (used for ordering genotyping assays)
KASP Sequence:
AATGTCCAGCAGAGATTCCAACCGCTGAGAACAGTAACGTGAAATTTTTC[A/T]GAGATTATGAGATGACCACCACAGGGGTAAGCTGCAAATGCACATGATCA
Long Flanking Sequence:
AAACATGTATAATAATATTTAAAGATGATATTTTTTATTTTGCGTATGAATTTAATTTTAAATTAAGTAAAAACTGAGTAATTTGCCAAATCAAAAAATATGTTTTATAACATTTTGAAAATGATCTCAGGTGACTTTGAGGATTTCGATTACATGATAATGGACTTAGATACGAACATCACAGTGACTGAAGCTGTGAAAGGGAAGGCCAGCATGGAGACATTTACGCTGCTGTGGGCAGAAGTTCCATCCCTCCCTCTGCCTTTCAATGCTTCTGAAACTGAGGTTCACCTTTGCTTTATATCTCTTAAAATTGACCATAGAATGTGTACCAAACTTTTACAACTTTTCTTTAAATGTTTCATACCTATATGATGGGTTTCATCTGTGTTTATTTTGTTTTTTATCAAATAAAGGTGCGTTCAGCACTAGATTTGATGATCACAGCTAAATGTCCAGCAGAGATTCCAACCGCTGAGAACAGTAACGTGAAATTTTTC[A/T]GAGATTATGAGATGACCACCACAGGGGTAAGCTGCAAATGCACATGATCATACGGTACATGTTTTACATGCTGAGCACTATTTAGTGAAGTTTATTCATAAACTAATTTCGAGAGGAGCACGTGATTATGATTGAACACGGCTGGTTCTGCATTAGCATGCTTGATCCACCAATCAGGCCATTCCTAACCACTATAAAGAGCCAGGGTTTTCTCACTACAGTTATCTTCGATTTGAAGAATCCCCCCTTCCACCCCTACCTTTTCACCTTTCCCTCCATAGGGCAGCACGGTGGCTCAGTGACTAGCACTGTCGCCTCACAGCAAGAACGTCACCGGTTCTAGTTCCTTAACAGGCCGGTGGTCGTTTCTGTGTGTAGTTTGCATGTTCTTCCCGTGCTTGCGTGGGTTTTCCCCGGGTTCTCCGGTTTCCTCCCACATTCCAAAAACATGTACAACAAGTTAATCGTTAAATCTAAATTTCAATACAGGTAATCTAATA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461