Busch Lab

ZMP

zgc:77118

Ensembl ID:
ENSDARG00000093176
ZFIN ID:
ZDB-GENE-040426-2211
Description:
hypothetical protein LOC405845 [Source:RefSeq peptide;Acc:NP_998074]
Human Orthologue:
PPT2
Human Description:
palmitoyl-protein thioesterase 2 [Source:HGNC Symbol;Acc:9326]
Mouse Orthologue:
Ppt2
Mouse Description:
palmitoyl-protein thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:1860075]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa7294 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7294
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007636 None 162 291 5 9
ENSDART00000099642 Essential Splice Site 91 105 None 10
Genomic Location (Zv9):
Chromosome 15 (position 34414712)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35260488
GRCz11 15 35118457
KASP Assay ID:
554-4529.1 (used for ordering genotyping assays)
KASP Sequence:
CCYRAGTCCTCACTGCACAATGTTTGTTATACTGAACTTGGACAAAAAAC[C/A]TCCTTCTGCAGCTACTGGAATGGTAAGATGTGCTACTTTCATGCATCAGC
Long Flanking Sequence:
TGCCTCTGGATCCCCTCGGAGGAGCTGGAGAGTGTTTGGGGAGATGGAAGTCTGGGGTTCTGTCTTAAGACTGCTGCCCCTGCGACTCTGCCCCAGAAAAGCCGATTATAAATGAATGAATTTCTATTTTTGCTGCACACTCACTGGTACACGATTAAATGTAGAACCAATAAAACGGAGCTGAAACTCCTCCAGACCTCAGTTTACTTGTCATATAATTTGTGTAACAGGTGGTTTGATATGTCGAGGAGTTCTTGCTACTCTTCCTCAACACAATGCTCACTCTGTGATATTCCTGTCTTCACCGCTAGCTGGCCAGTATGGAGGTCAGTGACGTTCACAGCACAATATTTATTCTCATTCAAGAAACAAGACCTTGTACACATGCATAAGTGCTTTCTCCATGTTCTTGCAGTTACAAGGGCCATCAGCGGTGTGTTCCCTAAACTGCCTAAGTCCTCACTGCACAATGTTTGTTATACTGAACTTGGACAAAAAAC[C/A]TCCTTCTGCAGCTACTGGAATGGTAAGATGTGCTACTTTCATGCATCAGCGTAACCTCCGGCTCTGTCTGTGACTCATTACGTTTCATCTGCTGCTGCTTGCACTGTAGATCCACATCATAGAGAGAAATACTTGAATTCCAGTGTCTTTCTGGCCCCGCTGAATGGAGAAGTTGAACATGTCAACTCAACAGGTAACTAAGCTATTAATTTGCCTAAAATTATTCTGTTATTCATCAATTGCTCATGTCTTTCCAATGCCCTGATACCTTATCTTTAGAACACTTTGTATTTTACTTATGTATTTATTTGTTTCTGTTTATTTAAAAACTATATATTTAATAAATTTATTTGATTTATATTTAATTTTAATTATTTTATTTTCATTCAATCGCTATCCAAACGATTTATGCAACCAAATATCTTTTAGTTGAAGTCAGAGAGCTCTCTCATCCGCCATACATGCAGCAATGATCTGGAGATGTTCCAGAAAGTCCAGAA
Associated Phenotype:
Not determined