Busch Lab

ZMP

zgc:55983

Ensembl ID:
ENSDARG00000093133
ZFIN ID:
ZDB-GENE-030131-5803
Description:
Zgc:55983 protein [Source:UniProtKB/TrEMBL;Acc:Q6PFN3]
Human Orthologue:
MICAL1
Human Description:
microtubule associated monoxygenase, calponin and LIM domain containing 1 [Source:HGNC Symbol;Acc:20
Mouse Orthologue:
Mical1
Mouse Description:
microtubule associated monoxygenase, calponin and LIM domain containing 1 Gene [Source:MGI Symbol;Ac

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa7303 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7303
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134369 None None 99 1 4
ENSDART00000140660 Essential Splice Site None 347 1 7
ENSDART00000144158 None None 149 1 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8562130)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8801935
GRCz11 1 9486046
KASP Assay ID:
554-4901.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCAGGAGTTTCAGGGATTTCTTAACTGCAGCTGACGGTGAAATTAGTG[G/A]TGAGTGTTTGTGTGTGTGAGAGATTAAGCAAAAWTCCTTCAGCATTCAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7895
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134369 Nonsense 67 99 3 4
ENSDART00000140660 Nonsense 67 347 4 7
ENSDART00000144158 Nonsense 67 149 3 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8555218)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8795023
GRCz11 1 9479134
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTTATTGCTGAGTGCTTTTTTTTCTTTCTTTTTTTAAACCAGGCTTTC[G/T]AAGTGGCAGAGAAGGAGTTGGGAATACCTGCCCTCCTGGATGCTGAAGAC
Associated Phenotype:
Not determined