Busch Lab

ZMP

si:ch73-112l6.1

Ensembl ID:
ENSDARG00000093126
ZFIN ID:
ZDB-GENE-091204-14

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa43637 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43637
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138128 Nonsense 134 1025 3 10
Genomic Location (Zv9):
Chromosome 21 (position 21348648)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22360141
GRCz11 21 22396777
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTGCGGACTGCACAACACCGTCAGAAAGGTTTTGGACATCAGCGGCTG[G/A]TATTTCATGGTCACAGAGTATTTGGAGTGCTGTTCCTGTAGGAAGAAGGT
Associated Phenotype:
Not determined