Busch Lab

ZMP

ENSDARG00000093114

Ensembl ID:
ENSDARG00000093114

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa2149 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa2149
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144277 Essential Splice Site 23 354 2 6
ENSDART00000144277 Essential Splice Site 23 354 2 6
Genomic Location (Zv9):
Chromosome 4 (position 44459374)
KASP Assay ID:
554-2528.1 (used for ordering genotyping assays)
KASP Sequence:
CAATCCTCAAACTGTGTGCTGAGAGCTGGACCTGAGTAACAATGACCTGC[A/C]GGATTCAGGAGTAAAGCTTCTCTCTGATGGACTGAAGAGTCAACACTGTA
Long Flanking Sequence:
TGAAAAGTTAAAGGAGTCTTTTCCTTTTCCCTGAGGAGAAATCACTCATCATGGGAACATCAATAATTACATGCACACTCACACACAATAATACAGTGTCTTTTACTGTCCTCTACACAGGCTACAGTGCAGTAAACTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTCCTGAGAGAGCTGGACCTGAGTAACAATGACCTGCAGGATTCAGGAGTGAAGCTTCTCTCTGATGAACTGACGAGAAACTGTAAACTGGAGACACTAAGGTCTGAGTTCAAACAACTAATTGATTGATTGATTGATTTTGATTTTACATCAGATGAATGACTGAAAGCCCGCGGTTAATGTAATCTGTGTTCTTCTTTCTCAGATTGGCCATGTGTAATCTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTGCTGAGAGCTGGACCTGAGTAACAATGACCTGC[A/C]GGATTCAGGAGTAAAGCTTCTCTCTGATGGACTGAAGAGTCAACACTGTAAACTGGAGAAACTGAGGTCTGAGTTCAAACAACTGATTGATTGATTGATTGATTGATTGAATAATTGATTGATTTTGATTTTACCTTAAATGAATGACTGAAATCCCGCTGTTAATGTAATCTGTGTTCTTCTTTCTCAGATTGGTCACGTGTAATCTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTGCTGAGAGAGCTGGACCTGAGTAACAATGACCTGCAGGATTCAGGAGTGAAGCTTCTCTCTGATGAACTGAAGAGTCAACACTGTAAACTGGAGACACTGAGGTAAATGATTCTCCACTTAATAATGACTACAACAAGATAGTTTCATATTGGGTTAACAAATGTAGAGCCCCTTTCAGTTTATTGGCTGAAAATAAAAAAAACATTTACAGGGTTGTGATTTTAATTGTAACTATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7324
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144277 Essential Splice Site 23 354 2 6
ENSDART00000144277 Essential Splice Site 23 354 2 6
Genomic Location (Zv9):
Chromosome 4 (position 44459374)
KASP Assay ID:
554-2528.1 (used for ordering genotyping assays)
KASP Sequence:
CAATCCTCAAACTGTGTGCTGAGAGCTGGACCTGAGTAACAATGACCTGC[A/C]GGATTCAGGAGTRAAGCTTCTCTCTGATGGACTGAAGAGTCAACACTGTA
Long Flanking Sequence:
TGAAAAGTTAAAGGAGTCTTTTCCTTTTCCCTGAGGAGAAATCACTCATCATGGGAACATCAATAATTACATGCACACTCACACACAATAATACAGTGTCTTTTACTGTCCTCTACACAGGCTACAGTGCAGTAAACTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTCCTGAGAGAGCTGGACCTGAGTAACAATGACCTGCAGGATTCAGGAGTGAAGCTTCTCTCTGATGAACTGACGAGAAACTGTAAACTGGAGACACTAAGGTCTGAGTTCAAACAACTAATTGATTGATTGATTGATTTTGATTTTACATCAGATGAATGACTGAAAGCCCGCGGTTAATGTAATCTGTGTTCTTCTTTCTCAGATTGGCCATGTGTAATCTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTGCTGAGAGCTGGACCTGAGTAACAATGACCTGC[A/C]GGATTCAGGAGTAAAGCTTCTCTCTGATGGACTGAAGAGTCAACACTGTAAACTGGAGAAACTGAGGTCTGAGTTCAAACAACTGATTGATTGATTGATTGATTGATTGAATAATTGATTGATTTTGATTTTACCTTAAATGAATGACTGAAATCCCGCTGTTAATGTAATCTGTGTTCTTCTTTCTCAGATTGGTCACGTGTAATCTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTGCTGAGAGAGCTGGACCTGAGTAACAATGACCTGCAGGATTCAGGAGTGAAGCTTCTCTCTGATGAACTGAAGAGTCAACACTGTAAACTGGAGACACTGAGGTAAATGATTCTCCACTTAATAATGACTACAACAAGATAGTTTCATATTGGGTTAACAAATGTAGAGCCCCTTTCAGTTTATTGGCTGAAAATAAAAAAAACATTTACAGGGTTGTGATTTTAATTGTAACTATAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26337
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144277 Essential Splice Site 49 354 2 6
Genomic Location (Zv9):
Chromosome 4 (position 44459292)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAAGAGTCAACACTGTAAACTGGAGAAACTGAGGTCTGAGTTCAAACA[A/C]CTGATTGATTGATTGATTGATTGATTGAATAATTGATTGATTTTGATTTT
Long Flanking Sequence:
ACACAATAATACAGTGTCTTTTACTGTCCTCTACACAGGCTACAGTGCAGTAAACTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTCCTGAGAGAGCTGGACCTGAGTAACAATGACCTGCAGGATTCAGGAGTGAAGCTTCTCTCTGATGAACTGACGAGAAACTGTAAACTGGAGACACTAAGGTCTGAGTTCAAACAACTAATTGATTGATTGATTGATTTTGATTTTACATCAGATGAATGACTGAAAGCCCGCGGTTAATGTAATCTGTGTTCTTCTTTCTCAGATTGGCCATGTGTAATCTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTGCTGAGAGCTGGACCTGAGTAACAATGACCTGCAGGATTCAGGAGTAAAGCTTCTCTCTGATGGACTGAAGAGTCAACACTGTAAACTGGAGAAACTGAGGTCTGAGTTCAAACA[A/C]CTGATTGATTGATTGATTGATTGATTGAATAATTGATTGATTTTGATTTTACCTTAAATGAATGACTGAAATCCCGCTGTTAATGTAATCTGTGTTCTTCTTTCTCAGATTGGTCACGTGTAATCTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTGCTGAGAGAGCTGGACCTGAGTAACAATGACCTGCAGGATTCAGGAGTGAAGCTTCTCTCTGATGAACTGAAGAGTCAACACTGTAAACTGGAGACACTGAGGTAAATGATTCTCCACTTAATAATGACTACAACAAGATAGTTTCATATTGGGTTAACAAATGTAGAGCCCCTTTCAGTTTATTGGCTGAAAATAAAAAAAACATTTACAGGGTTGTGATTTTAATTGTAACTATATTAATGTATGTTTATAAAAATATATTTAATAGCATTGCTGAGTTTATTATAAAATGTTGCACTTTCAGACCTTTTCTTTTTCC
Associated Phenotype:
Not determined