Busch Lab

ZMP

si:dkeyp-31a2.1

Ensembl ID:
ENSDARG00000093107
ZFIN ID:
ZDB-GENE-081104-463
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JJT3]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa34322 Nonsense Mutation detected in F1 DNA Not yet available
sa16106 Splice Site, Nonsense Available for shipment Available now
sa34323 Nonsense Mutation detected in F1 DNA Not yet available
sa15429 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34322
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132885 Nonsense 139 172 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11645839)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11023285
GRCz11 8 11060990
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAGCCGCCGCTCGGGTCTTTATCACGCCCTGTCTGAAGACAGCATCTA[T/A]GAGGACATCATCTGTGAGTTATACTGATATCATCCAACTGGTATTACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16106
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132885 Splice Site, Nonsense 144 172 3 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11648867)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11020257
GRCz11 8 11057962
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTACAATGTTATCTATAATCTTCAACRTTTTTTAACTATTTGTTTGCAG[C/A]GGATATGCCAAAAGAAAACCCATATGAAGATATCACGCTTTCTCCCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34323
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132885 Nonsense 167 172 3 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11648935)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11020189
GRCz11 8 11057894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCATATGAAGATATCACGCTTTCTCCCATGTGTTTACCTATAAGGCGG[C/T]AACGAAACTACACAGTTGGACAAAGAGAAAGGCCACAGCTCAAGGTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15429
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132885 Nonsense 168 172 3 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11648938)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11020186
GRCz11 8 11057891
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATATGAAGATATCACGCTTTCTCCCATGTGTTTACCTATAAGGCGGCAA[C/T]GAAACTACACAGTTGGACAAAGAGAAAGGCCACAGCTCAAGGTGACTGTC
Associated Phenotype:
Not determined