Busch Lab

ZMP

ENSDARG00000093050

Ensembl ID:
ENSDARG00000093050

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40827 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40827
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132550 Nonsense 116 141 2 3
Genomic Location (Zv9):
Chromosome 7 (position 5578318)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACAACCAAACAGCAATGATAATTGCACTTATATGATAAATAAACAGTG[G/A]TATGTTAGGCCATGTAATGCCACCTCAACCTTCATCTGCTACAACAGTGA
Associated Phenotype:
Not determined