Busch Lab

ZMP

si:ch211-14k19.8

Ensembl ID:
ENSDARG00000092972
ZFIN ID:
ZDB-GENE-051214-4

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25524
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146642 Nonsense 39 174 2 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8179577)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8419382
GRCz11 1 9103493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGTTATCGCAGATTTAATCACTTTGATGAGCTTTCGGCTCGTTTTTG[G/A]GGAAGGTCCTGGCCTGGCTCTGAGGACTCTCTGGATAACCCTGGCTTCAC
Long Flanking Sequence:
ACTAGGCTTTCTAGAAACATCTTTGCAGGTGTGTTGAGGCAAGTTGGAGCTCAAATCTGCAGGACACCGGCCCTCCAGGACTGAGTTTGGACATCCCTGGTCTAATCCAATTAATGATTAATGCGAAGCTAAGCTAAAAGTGTTCCTGGAAGTTTCTGTGATGGACTGAACAGATTAAAAATGGCCAACTGTTTACATCTAGTAGAGTTGTAAAATGAGCTTATTTTTTAAAAAAGTGGAATGTTCCTTTAAACACACACGCACACACAAATCTGTCTGTTTTTGTTATTGGAAACAGTTTGCAGGAAGCCATCACACTATGGGTTTGTGATAGCACCACTTAAAGGGAGGGAATGGGTTGTGTGATCACACACAGACACACTACTGTAAATTAATTTTACTAACAATCCATTGTGTTCTGTGTGTGTGTCTTCTGTGTGTGTGTGTGGACACAGTTATCGCAGATTTAATCACTTTGATGAGCTTTCGGCTCGTTTTTG[G/A]GGAAGGTCCTGGCCTGGCTCTGAGGACTCTCTGGATAACCCTGGCTTCACCCGCTCAGATGAACTGCTTCACCTGAGGGCTCTCGACCGCACCTGCTGTTACCATGACGACACTCTATCAGTGGTGTCCACATACCATGGTAGCGGAGCACACCTCAACACTGTATATCCTCATGGGTACAGTATGATTTATGGGATATTATCAAATGAACAATGGTGCTTGCCGTTTGTTTTACACTGTTCATTCATTCATTTTCTTGTCGGCTTAGTCCCTTTATTAATCTGGGGTCGCCACAGCAGAATGAACCGCCAACTTATCCAGCAAGTTTTTACTCAGCGGATGCCCTTCCAGCTGCAACCCATCTCTGGGAAACATCCACACACACATTCACACACACTCATACACTACGGACAATTTAGCCTACCCAATTCACCTGAACCGCATGTCTTTGGACTGTGGGGGAAACCGGAGCACCCGGAGGAAACCCACGCGAACGCAGG
Associated Phenotype:
Not determined