Busch Lab

ZMP

notch2

Ensembl ID:
ENSDARG00000092960
ZFIN ID:
ZDB-GENE-000329-4
Description:
notch homolog 2 [Source:RefSeq peptide;Acc:NP_001108566]
Human Orthologues:
NOTCH2, NOTCH2NL, RP11-458D21.5
Human Descriptions:
notch 2 N-terminal like [Source:HGNC Symbol;Acc:31862]
notch 2 [Source:HGNC Symbol;Acc:7882]
Mouse Orthologue:
Notch2
Mouse Description:
Notch gene homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97364]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa31643 Nonsense Available for shipment Available now
sa34370 Nonsense Mutation detected in F1 DNA Not yet available
sa7129 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25391 Nonsense Mutation detected in F1 DNA Not yet available
sa41176 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34371 Nonsense Mutation detected in F1 DNA Not yet available
sa41177 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38684 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31643
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Nonsense 516 2475 9 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20131434)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19561331
GRCz11 8 19593416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTCAGCTCACCTTGTCTTAATAACGGTAGATGTCTAGACCAGGTCAGC[C/T]GATTCGTCTGCGAGTGTCCTCAGGGTCAGTATAATGATTGGTGCAGTCAA
Long Flanking Sequence:
ATAGTTTGCTTTTCTCTTCTTTGTTTTTTTCTGCATTGCCTCTTTTACTGCATACACAGTTGATTATTTTTTCATATCTTACCTGAATCTTTTTTTTGATCCATCAGGGCCAAACCCATGTGAGCATGGAGGCTCATGTAAGAACACAGAGGGGTCCTTCACTTGTAACTGCGCTCCAGGTTACACCGGCCCACGTTGTGAGCAGGACATCAATGAATGTGGCTCCAACCCCTGCCAGAATGATGCCACCTGCTTGGATCAGATAGGAGATTACACCTGTATCTGTATGCCAGGTACTGCATTTACGCTCTCTCACACGCTCTATAATCCATTGGAAGATGGCATTTTTTGGCTCTGTGTCTTTATAATAATCTCATGATGATGTGTGTTTGTCTGTGTTCCCCTTCATAGGCTTTGATGGAACACACTGTGAAAATGACATTAATGAGTGTCTCAGCTCACCTTGTCTTAATAACGGTAGATGTCTAGACCAGGTCAGC[C/T]GATTCGTCTGCGAGTGTCCTCAGGGTCAGTATAATGATTGGTGCAGTCAAACAACAATATGGAAGGCACCCATACAGTGCATCCAAAAAGTTTTTACAGCACTTTAATTTTTTCCATTTTTGTTGTTATAGCCTCATTTAAAAGTTGATTAAATTCATTGTTTTTCTCAAACATTCTACAAACACTTCCCTACAATTCCAACGTGAAATTAATTTATTTGACATCTTTCCAAAAGGGTAATAAGTATTTACAGCATTTACCAATAGTCAAAATAGAGATGCTTTCTGTTTCCTCTGATCATCCTTGAGGTGTTTCTACTTGATTGGAGTTGACCTGTTGTAAATTCAGTTGATTGGACGTGATATGGAAAGGCATTTAACTGTCAATTATAAGGTTCCACTGTTAACAGTGCATGTCAGGAAGAAGCTAAAGCACATTTCTGGCCAAATTAAGCATTCAGAGAAAAAACGCCTTTCTTAGTGAGGTGACCAAGAACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34370
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Nonsense 667 2475 12 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20134590)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19564487
GRCz11 8 19596572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAGTAATCCCTGCCAGCACGGGACCTGTGAGGATGGAATCAATGAGTA[C/A]AAATGCGTGTGCGAACCTGGATACACAGGTTTGTTCATCCCACATGCACA
Long Flanking Sequence:
TAATCAGCTGATCTTTGTGTGGAAAATCTCTGAGCTTGTGTGCTTCTATTTTAATTGCCTGATCATCAATGACACAACAGAATATTAAAGAACAACTGTTTGCTTGATTTATGCAAGTAATCTGGGGATACTGGTCAAAAAGATTTGTGCAGTGAATAATGGAGTATGTCTACTTTGTCCATCTCCCTGCTTTATTTTTGACAAATCCTATATTCTGAAAAAGTCCTATATTCCTCAATCTAATAAAAGAAATAAAGCTCACTTAACCCCCCTGCTGGATGCATGCTCTTACTACACACACACACACACACACACACACTTAGGAAATAAGGGCATTATGTAAACTTTCTTGCAGACGTTTTCAAGAGCTGCTGTGTAAAGCTTCTTTTGATTATTTTTCCATTTATTTTCATTATAGGTGAGAACTGTCAGATTAACTATGATGACTGTGCCAGTAATCCCTGCCAGCACGGGACCTGTGAGGATGGAATCAATGAGTA[C/A]AAATGCGTGTGCGAACCTGGATACACAGGTTTGTTCATCCCACATGCACAAATATAAATACACATATGCAGATGTGCTTCAGTCATTAAGTTCTGTGTAAATAGTTTGTAACACAACCACACAATGCATCTCTTCAATTTGATAAATCATACGTGTCAAACTCCAGTTCTGGAGGGCCACAGCCCCATACAATTTAGTTTTAACCGCAATGAAACACACCTGATCAAACTAATTAAGTCCTTCAGGCTTATTGTAGGTTTGTGTGTTGAAGCAAGGTTGGAACTTAACTCAGCAGGGTTGTGGCCCTTTAATAGCTGAGTATGACACCACTGATATATGATTGTGCTGCTTCAATCAACAGTGAAAGTTTTCATTATTCACTCTTTTTTTTTTGTTTCAGGGGAACGATGCGCTGATGAGATCAATGAGTGCAGTTCAAACCCATGTCAGAGTGGGGGGACGTGTGAGGATAAAGTGAATGGATTTAAGTGCAAGTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7129
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Essential Splice Site 790 2475 None 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20137043)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19566940
GRCz11 8 19599025
KASP Assay ID:
554-4892.1 (used for ordering genotyping assays)
KASP Sequence:
AATGACCGTCTGAATGATTAYACCTGCKTATGCGCCCGTGGGTTTGCAGG[T/G]AATGGCATGTGATCCTTTCTAAACAAAGTAACAAAGACATTTAGKTCATA
Long Flanking Sequence:
TGAGAATAAGCACAACCCTGTTAGACCATGCGCCGCGGCGCAAATTGTATTTTTCCATCCTTAAAATAGCAAAAAAGGATTTAGACACTCCCTTAATGCTTTTGCTCCATGCACTTTAGACTTTGCGCCTAGATCATTAAAATAGAGCCCTTTGTGTTTTTATATTTCCAGGCAAAGTTCTGTGTCATGATTTGTTTAGGTGTAGTAGCATTCGTTTAAATTATTTGTCCAAAATATAACAAATGCTGTGTTTTGTGAGCTTATTATAAGGAACTATTATATGTTTAAATATACAGTATAAATCCTCCTCAGTGGCCTTTGTTCCTTACTATTTTCAACTGTTTTCTGTGTAGGTATCTTTGTCAATGTGAGCCAGGCTGGGAGGGTACGAACTGTGACCAAGAGAAGAACGAGTGTCTGTCCAACCCGTGTCAGAATGGTGGAACCTGTAATGACCGTCTGAATGATTATACCTGCGTATGCGCCCGTGGGTTTGCAGG[T/G]AATGGCATGTGATCCTTTCTAAACAAAGTAACAAAGACATTTAGGTCATACTCCAACTCCCTGGTTTGCCCTTTCTTTCATTCAGGTTTCAACTGTGAGATCAACATAAATGAATGTGAGTCAAACCCCTGCATGAATCAGGGAACCTGTGTGGATGGAGTCAACAGCTACGTATGCCACTGCAAACCACCTTACACAGGTGATGCACATATTTACAGTCTACAGTTGTCAAAAACACTTTTTTCTTACTTGATTTGACTTCTATAAGCAACATTTATGACACTTAAGTTGTCAGATTTTATAAACTTGATATGAATATGTGAGTTCCCAAATTAAAGTGTTATAATTGTGTTTGACAAATGTATTCATTCATTCATTCATTCATTCATTCATATGTATTGGCAAAATATTTTTATCTATTTGAAAGACACCAAAACTGATAACCTTGCAAAATTTGTTATATACATATAAAAATAAATAATACATTCTAATAATAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25391
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Nonsense 800 2475 15 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20137160)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19567057
GRCz11 8 19599142
KASP Assay ID:
554-7785.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCCTTTCTTTCATTCAGGTTTCAACTGTGAGATCAACATAAATGAATG[T/A]GAGTCAAACCCCTGCATGAATCAGGGAACCTGTGTGGATGGAGTCAACAG
Long Flanking Sequence:
AGACTTTGCGCCTAGATCATTAAAATAGAGCCCTTTGTGTTTTTATATTTCCAGGCAAAGTTCTGTGTCATGATTTGTTTAGGTGTAGTAGCATTCGTTTAAATTATTTGTCCAAAATATAACAAATGCTGTGTTTTGTGAGCTTATTATAAGGAACTATTATATGTTTAAATATACAGTATAAATCCTCCTCAGTGGCCTTTGTTCCTTACTATTTTCAACTGTTTTCTGTGTAGGTATCTTTGTCAATGTGAGCCAGGCTGGGAGGGTACGAACTGTGACCAAGAGAAGAACGAGTGTCTGTCCAACCCGTGTCAGAATGGTGGAACCTGTAATGACCGTCTGAATGATTATACCTGCGTATGCGCCCGTGGGTTTGCAGGTAATGGCATGTGATCCTTTCTAAACAAAGTAACAAAGACATTTAGGTCATACTCCAACTCCCTGGTTTGCCCTTTCTTTCATTCAGGTTTCAACTGTGAGATCAACATAAATGAATG[T/A]GAGTCAAACCCCTGCATGAATCAGGGAACCTGTGTGGATGGAGTCAACAGCTACGTATGCCACTGCAAACCACCTTACACAGGTGATGCACATATTTACAGTCTACAGTTGTCAAAAACACTTTTTTCTTACTTGATTTGACTTCTATAAGCAACATTTATGACACTTAAGTTGTCAGATTTTATAAACTTGATATGAATATGTGAGTTCCCAAATTAAAGTGTTATAATTGTGTTTGACAAATGTATTCATTCATTCATTCATTCATTCATTCATATGTATTGGCAAAATATTTTTATCTATTTGAAAGACACCAAAACTGATAACCTTGCAAAATTTGTTATATACATATAAAAATAAATAATACATTCTAATAATAATATTTTAGGATGCTTTTATGAATAGACAGCTCAAAACAGATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATATTATGTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27171
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Essential Splice Site 867 2475 16 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20138964)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19568861
GRCz11 8 19600946
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCGCTGGATTACACCAGCTACACCTGCAAATGCCACAGCGGCTGGGAGG[G/A]TGAGCGCTTCAAGTCTGGGTGTTGGTGTGATTACATATTTAAGTCAGTTA
Long Flanking Sequence:
CAGCATTTGAATAACTAAATGTAAAAACACTGTGTAGTTCGCTGTAAAAATAATTCAATATAAGATACAAATGGTAAATTTATTGTGCTTGAATTCTTAGTCATAGGCCTTAAAAACACATTCACTCCGTTATCCTTACGTCCTGCAGTGATTCCACAAATCACATCTAAAAGATTTCTCCTAGACAACTAATTGCAACATATGAACTCAACATTGCATTTCCTGCGATGTGACTATTGCAGATACACACATTGCAATATCGATAATGAAACGAAATAGTGTGCAGCCCTATTTTGGGGTTTTTACACTATGGGACCTGTACCAAATCCAGCTGAACAGCATTAAATTCTCCACAACTGACTGGACTTTTCACTTCTCAGGGAAACACTGTCTGGAGAAGTTGATCCCATGTGCCTCTCAGCCCTGTCAGAGACGAGGAGTCTGTCAGCCATCGCTGGATTACACCAGCTACACCTGCAAATGCCACAGCGGCTGGGAGG[G/A]TGAGCGCTTCAAGTCTGGGTGTTGGTGTGATTACATATTTAAGTCAGTTAAATGTCTGTTGAAGGAACAGTATCAATAGATATTAAGCTGACAGTCTACTAATACTTAAATGGACCATCAAAATAAAGTGTTTCTCATATTTGATCTGAGACGATCACATATAAACTTTTCCTTGATAAAACATGATGTGAGCTGTGGACATCTATTAAAAGTGTCTGAAGGGATTTTGTCTGGTATGTGTGTGCAGGAGCCCAATGCACAGAGGATAAAGACGAGTGTAAGAAGAGCCCTTGTCAGAATGGTGCTCGCTGTGTGAATATAGTTGGCAGCTACCGTTGCGAATGCCCGCCTGGATACAGCGGGGACAACTGCCAGACCAACATCGATGACTGCAGCTCTAGTACGTGTCTTTCCCACACCGATTTTTCTATATGCAGTGGCTTGGTGGGCACATGCGCGTGTCCTTCTGTTAATATCTTGTTAAAGGAGGGTCGTGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41176
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Essential Splice Site 868 2475 None 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20138965)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19568862
GRCz11 8 19600947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCGCTGGATTACACCAGCTACACCTGCAAATGCCACAGCGGCTGGGAGGG[T/C]GAGCGCTTCAAGTCTGGGTGTTGGTGTGATTACATATTTAAGTCAGTTAA
Long Flanking Sequence:
AGCATTTGAATAACTAAATGTAAAAACACTGTGTAGTTCGCTGTAAAAATAATTCAATATAAGATACAAATGGTAAATTTATTGTGCTTGAATTCTTAGTCATAGGCCTTAAAAACACATTCACTCCGTTATCCTTACGTCCTGCAGTGATTCCACAAATCACATCTAAAAGATTTCTCCTAGACAACTAATTGCAACATATGAACTCAACATTGCATTTCCTGCGATGTGACTATTGCAGATACACACATTGCAATATCGATAATGAAACGAAATAGTGTGCAGCCCTATTTTGGGGTTTTTACACTATGGGACCTGTACCAAATCCAGCTGAACAGCATTAAATTCTCCACAACTGACTGGACTTTTCACTTCTCAGGGAAACACTGTCTGGAGAAGTTGATCCCATGTGCCTCTCAGCCCTGTCAGAGACGAGGAGTCTGTCAGCCATCGCTGGATTACACCAGCTACACCTGCAAATGCCACAGCGGCTGGGAGGG[T/C]GAGCGCTTCAAGTCTGGGTGTTGGTGTGATTACATATTTAAGTCAGTTAAATGTCTGTTGAAGGAACAGTATCAATAGATATTAAGCTGACAGTCTACTAATACTTAAATGGACCATCAAAATAAAGTGTTTCTCATATTTGATCTGAGACGATCACATATAAACTTTTCCTTGATAAAACATGATGTGAGCTGTGGACATCTATTAAAAGTGTCTGAAGGGATTTTGTCTGGTATGTGTGTGCAGGAGCCCAATGCACAGAGGATAAAGACGAGTGTAAGAAGAGCCCTTGTCAGAATGGTGCTCGCTGTGTGAATATAGTTGGCAGCTACCGTTGCGAATGCCCGCCTGGATACAGCGGGGACAACTGCCAGACCAACATCGATGACTGCAGCTCTAGTACGTGTCTTTCCCACACCGATTTTTCTATATGCAGTGGCTTGGTGGGCACATGCGCGTGTCCTTCTGTTAATATCTTGTTAAAGGAGGGTCGTGCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34371
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Nonsense 909 2475 17 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20139336)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19569233
GRCz11 8 19601318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGGCAGCTACCGTTGCGAATGCCCGCCTGGATACAGCGGGGACAACTG[C/A]CAGACCAACATCGATGACTGCAGCTCTAGTACGTGTCTTTCCCACACCGA
Long Flanking Sequence:
CTTCTCAGGGAAACACTGTCTGGAGAAGTTGATCCCATGTGCCTCTCAGCCCTGTCAGAGACGAGGAGTCTGTCAGCCATCGCTGGATTACACCAGCTACACCTGCAAATGCCACAGCGGCTGGGAGGGTGAGCGCTTCAAGTCTGGGTGTTGGTGTGATTACATATTTAAGTCAGTTAAATGTCTGTTGAAGGAACAGTATCAATAGATATTAAGCTGACAGTCTACTAATACTTAAATGGACCATCAAAATAAAGTGTTTCTCATATTTGATCTGAGACGATCACATATAAACTTTTCCTTGATAAAACATGATGTGAGCTGTGGACATCTATTAAAAGTGTCTGAAGGGATTTTGTCTGGTATGTGTGTGCAGGAGCCCAATGCACAGAGGATAAAGACGAGTGTAAGAAGAGCCCTTGTCAGAATGGTGCTCGCTGTGTGAATATAGTTGGCAGCTACCGTTGCGAATGCCCGCCTGGATACAGCGGGGACAACTG[C/A]CAGACCAACATCGATGACTGCAGCTCTAGTACGTGTCTTTCCCACACCGATTTTTCTATATGCAGTGGCTTGGTGGGCACATGCGCGTGTCCTTCTGTTAATATCTTGTTAAAGGAGGGTCGTGCAGCCTAGTGAGATTAAGAAGGACTCCTAAATAAGATGATTCTTATGTGACAAACAAACAAACAATAAAAAACTAATAGAATCTTTGGCTGTCAGTAAAATAAATAATTAAGGTTAATCTCATTACCAGTTTGAAGCAGAAAGAAGATAATTAGTTTGGTTGAGTATATTAAATTAACAAGTTAACTGTGACAGCCCAGAAAAGAAATTGTGTTTTGTATTTTCTGCCTGTCTACTCAATCTGGAAATACTTCAATTTTTTTTCTCATTTGTTTGTTCTCCAGATCCATGCCGTAACGGGGGTACATGTGTTGATAAAGTGGGCCGGTACTTGTGCGAGTGCAGAGCTGGTTTTTATGGCGAGCGCTGTGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27172
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Nonsense 1090 2475 20 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20140910)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19570807
GRCz11 8 19602892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAATGGAGGTACTTGCATCCAGAAAGAAATCAATTGGAGATGCAGCTG[T/A]CAGCCTGGCTGGACAGGCCTGTATTGTGACATCCCCAGCATGTCCTGCCA
Long Flanking Sequence:
GCTGGTTGTTGGGACCTAAGAAAATACTATGGTAGTCAATGGGTTCCAGCAACCGGTATTTGTCACAATATCTTTATTTGTGTTCAACAGAAGAAATAAACAACATGAGGGAGAGTAAATAATGAGATATTTTTCAACTTTGGGTAAAATATCCCTTTGTTTTATGCATACTTTCTTGACCAAATGCTTTTTAAATGCATTTGCATTCTTTCAATACAGAAAATACAAACTAGTTATTTGTAGTGATTTGATCATTTGGTTGCTAGTAAAGACCCTGATATACTCAAGTGAAGCAGTATTTAGATGAAAACTATTTCAACATGTTTAAAATGATGTAATGCCAGTTTGTTCTACAGTTTCACTTTGATTTTGATGTATATCTTTCAGTGATTGGTGTATACACTTTTGTTTTTGCAGTCAATGGTGAATTTGTGCAGTCAGATTAAGTGTCAGAATGGAGGTACTTGCATCCAGAAAGAAATCAATTGGAGATGCAGCTG[T/A]CAGCCTGGCTGGACAGGCCTGTATTGTGACATCCCCAGCATGTCCTGCCACGCTGTTGCCCTCAACAAAGGTAATACATTAGACATCTTCAGTGTAATTCCTTTGGAAGATATTTTATGTATAAGTCTTTAATGTAAACTCTGGTGTGCTGCAGGTGTGGCGGAGAACATGGTCTGCAAGCACGCAGGTCATTGTAAGAACATAGGCAACACACATCAGTGCGAGTGTCAGAAGGGATATACGGGCAGTTACTGCGAGACTGAGATAGATGAATGTCTATCCAGCCCTTGCAGAAATGGAGGGACATGTGTGGACTACCAGGGTGGATATGACTGCAAGGTATCACCAATCTCACTTACTAACTGCTGAAAAGTGATTCTAAAACATGTTACAAATATTTTACAAATATTTCACATTAATGCAGTTCATTTGATTATGTAAATAATCCTGCAAAAGTATAATGTTTACCACAAATATAAAAATATAAGCAGCACAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41177
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Essential Splice Site 1114 2475 None 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20140982)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19570879
GRCz11 8 19602964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTGTGACATCCCCAGCATGTCCTGCCACGCTGTTGCCCTCAACAAAGG[T/A]AATACATTAGACATCTTCAGTGTAATTCCTTTGGAAGATATTTTATGTAT
Long Flanking Sequence:
TTTATTTGTGTTCAACAGAAGAAATAAACAACATGAGGGAGAGTAAATAATGAGATATTTTTCAACTTTGGGTAAAATATCCCTTTGTTTTATGCATACTTTCTTGACCAAATGCTTTTTAAATGCATTTGCATTCTTTCAATACAGAAAATACAAACTAGTTATTTGTAGTGATTTGATCATTTGGTTGCTAGTAAAGACCCTGATATACTCAAGTGAAGCAGTATTTAGATGAAAACTATTTCAACATGTTTAAAATGATGTAATGCCAGTTTGTTCTACAGTTTCACTTTGATTTTGATGTATATCTTTCAGTGATTGGTGTATACACTTTTGTTTTTGCAGTCAATGGTGAATTTGTGCAGTCAGATTAAGTGTCAGAATGGAGGTACTTGCATCCAGAAAGAAATCAATTGGAGATGCAGCTGTCAGCCTGGCTGGACAGGCCTGTATTGTGACATCCCCAGCATGTCCTGCCACGCTGTTGCCCTCAACAAAGG[T/A]AATACATTAGACATCTTCAGTGTAATTCCTTTGGAAGATATTTTATGTATAAGTCTTTAATGTAAACTCTGGTGTGCTGCAGGTGTGGCGGAGAACATGGTCTGCAAGCACGCAGGTCATTGTAAGAACATAGGCAACACACATCAGTGCGAGTGTCAGAAGGGATATACGGGCAGTTACTGCGAGACTGAGATAGATGAATGTCTATCCAGCCCTTGCAGAAATGGAGGGACATGTGTGGACTACCAGGGTGGATATGACTGCAAGGTATCACCAATCTCACTTACTAACTGCTGAAAAGTGATTCTAAAACATGTTACAAATATTTTACAAATATTTCACATTAATGCAGTTCATTTGATTATGTAAATAATCCTGCAAAAGTATAATGTTTACCACAAATATAAAAATATAAGCAGCACAATTGTTTTTACAGTGATAATATTAAGAAATTGAGAATGAAGTCTACATTTTAGAATGATTTCTGATGCTGAAAATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38684
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Splice Site, Nonsense 1508 2475 25 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20146644)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19576541
GRCz11 8 19608626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCTATTCGACAGCTTTGAATGCGACAAACATTCATCGGTGGGAATTTG[C/A]AAGTATGTTTACCAGTGTATTTTAATACTTTAGCACCTCACTTCTCTCTG
Long Flanking Sequence:
GGCTTTAACTGTGGCAATTATGAGATGTTCCCATGTGCCAGTTTACGCTGTCTGAATGGTGGACAGTGTGTGGAGATAAAGAGCCGCCCTCAGTGCCACTGCCCAGTGGGTTTTACTGGAACACACTGTGAGATGTTAACAAACCATTGCGTGTGTCAAAATGGTGGCACCTGCATGCCAGATGAGTCCAACAAGTTTAGCTGCCGGTGTCCACCAGGGTTTAGCGGGGAGACCTGTCAGGAGACTCCACCTTCTTGCCCTTATCCGGATTGCGAACAGCGGGCTGGAGACAAAGTATGTGACCTGCGTTGTAAGAACCCGGAGTGTGACTGGGATGGAAGTGACTGTACGCTCCACTGGGACAAACCCTGGAAGAACTGCAAAGCCTCAGTGTCCTGCCCAGACTTATTTCATAACGGCCGCTGTGACCCAGAGTGCAACAATGCAGGCTGCCTATTCGACAGCTTTGAATGCGACAAACATTCATCGGTGGGAATTTG[C/A]AAGTATGTTTACCAGTGTATTTTAATACTTTAGCACCTCACTTCTCTCTGCTAGGAAAATTGCTGATATAATTAAGCAGTATTTTACAAAACTACAGTTTTAGCATAAACCTGTCTCTGAAAAAAACAGGAAATGTACTGATAATGGTAGGGTTAGCCATGTCCTTTCTTATTCGGCACCAAACCAAATTGTGCACATTATGCCTACTAGATGTTAATTGCATTATGTTCTGGTATAAAATTTACAGCACATTTTAGACTTATTCAATTCAACTTATGTGCAAGAAAATAAATATTTATGTAAAGTCATAACGAGGACTCACCAGCACACACTTTCAGAGCCATAGCATTTTAGCCTTTATTTTCTATATTTCATTTTGCACTTTTGCTTAATCACTAATTTCATCTCTGCACTGACATGGAATAGATCAAAAAACATGTTCTAGCTCCAATCTCTCTTACCCTTGTTTTTCCTTAGATACGACAAATACTGTGCAGATC
Associated Phenotype:
Not determined