Busch Lab

ZMP

si:ch211-250g4.3

Ensembl ID:
ENSDARG00000092945
ZFIN ID:
ZDB-GENE-060503-506
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L949]
Human Orthologues:
AKAP9, CCDC88A, CCDC88C, CENPF, NUMA1, PCNT
Human Descriptions:
A kinase (PRKA) anchor protein (yotiao) 9 [Source:HGNC Symbol;Acc:379]
centromere protein F, 350/400kDa (mitosin) [Source:HGNC Symbol;Acc:1857]
coiled-coil domain containing 88A [Source:HGNC Symbol;Acc:25523]
coiled-coil domain containing 88C [Source:HGNC Symbol;Acc:19967]
nuclear mitotic apparatus protein 1 [Source:HGNC Symbol;Acc:8059]
pericentrin [Source:HGNC Symbol;Acc:16068]
Mouse Orthologues:
Akap9, Ccdc88a, Ccdc88c, Cenpf, Numa1, Pcnt
Mouse Descriptions:
A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI Symbol;Acc:MGI:2178217]
centromere protein F Gene [Source:MGI Symbol;Acc:MGI:1313302]
coiled coil domain containing 88A Gene [Source:MGI Symbol;Acc:MGI:1925177]
coiled-coil domain containing 88C Gene [Source:MGI Symbol;Acc:MGI:1915589]
nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]
pericentrin (kendrin) Gene [Source:MGI Symbol;Acc:MGI:102722]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3018
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139999 Nonsense 171 1041 4 4
Genomic Location (Zv9):
Chromosome 19 (position 39065895)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37929878
GRCz11 19 37516998
KASP Assay ID:
554-2989.1 (used for ordering genotyping assays)
KASP Sequence:
GAACTAAACAGGAAAGAACTGAGATAGACAACATGAAGCAGAAGATTCAG[A/T]GACAGCAAGATGAAATAACCAGAATGACCACAGAGAAAGGGCAACTGGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4065
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139999 Nonsense 549 1041 4 4
Genomic Location (Zv9):
Chromosome 19 (position 39067029)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37931012
GRCz11 19 37518132
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAGTTGGAGARTATAAGAGCAGAGATGCAAAGAGTRAATGACGTGGAG[A/T]AAGCCAAAATACTGAAAGAGAAAGAAGAAAGCATTAGGATAAGAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3038
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139999 Nonsense 966 1041 4 4
Genomic Location (Zv9):
Chromosome 19 (position 39068280)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 37932263
GRCz11 19 37519383
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGAACAGATGAGATTTCAGGTTGAGAATGAGAAGAAAGATCTRGAACAA[C/T]GAAGGTATGAGATGATGAGATATGATGTGGAACAGAGTGCTCAGGTGCAG
Associated Phenotype:
Not determined