Busch Lab

ZMP

si:ch211-146l10.5

Ensembl ID:
ENSDARG00000092924
ZFIN IDs:
ZDB-GENE-080215-16, ZDB-GENE-091112-14
Description:
hypothetical protein LOC100137113 [Source:RefSeq peptide;Acc:NP_001108182]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31099 Nonsense Mutation detected in F1 DNA Not yet available
sa24450 Nonsense Available for shipment Available now
sa1427 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124341 Nonsense 118 847 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9814646)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9873530
GRCz11 24 10013916
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACTCCCATGATAAGTGAAAAACAAGGCTCTGAATCGCATACAAGCCAA[C/T]AAGGATTTCATGTTGATTCAGTTGGAACTGGTAGTCTTGTTTATGGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24450
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124341 Nonsense 498 847 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9813504)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9872388
GRCz11 24 10012774
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCAGTCTGGGCCCTGGTTTGTTGTTCAACAACCAGCACAAATAGTCTA[C/A]CAGTCTGCTAGCCAGCCCACTGTGCCACACCTAGTAGAAACCATCTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1427
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124341 Nonsense 531 847 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9813407)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9872291
GRCz11 24 10012677
KASP Assay ID:
554-1348.1 (used for ordering genotyping assays)
KASP Sequence:
ACCAGTCTGCTTCCCAACAACCAGCACAAGCTAGCTACCAKTTGGTGGAA[C/T]AGCCAGCACAGGTCAGCTCATCTGTAGGCCATCTTCAAGCTGGACAGTCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461