Busch Lab

ZMP

si:dkey-23c22.5

Ensembl ID:
ENSDARG00000092892
ZFIN ID:
ZDB-GENE-081105-147
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0V326]
Human Orthologues:
LTBR, TNFRSF11A, TNFRSF4
Human Descriptions:
lymphotoxin beta receptor (TNFR superfamily, member 3) [Source:HGNC Symbol;Acc:6718]
tumor necrosis factor receptor superfamily, member 11a, NFKB activator [Source:HGNC Symbol;Acc:11908
tumor necrosis factor receptor superfamily, member 4 [Source:HGNC Symbol;Acc:11918]
Mouse Orthologues:
Ltbr, Tnfrsf11a, Tnfrsf4
Mouse Descriptions:
lymphotoxin B receptor Gene [Source:MGI Symbol;Acc:MGI:104875]
tumor necrosis factor receptor superfamily, member 11a Gene [Source:MGI Symbol;Acc:MGI:1314891]
tumor necrosis factor receptor superfamily, member 4 Gene [Source:MGI Symbol;Acc:MGI:104512]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa601 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa601
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132841 Nonsense 63 159 2 4
Genomic Location (Zv9):
Chromosome 8 (position 22988440)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22359616
GRCz11 8 22380855
KASP Assay ID:
554-0511.1 (used for ordering genotyping assays)
KASP Sequence:
TTTATTGGSACTGCACASATGACACCAGCACAACTTGTGTTCCATGTCCT[G/T]AATTAACTTTTACTGATGAACCCAATGGTTTAAAGGAATGCTTTCCTTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27188
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132841 Nonsense 123 159 3 4
Genomic Location (Zv9):
Chromosome 8 (position 22990019)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22361195
GRCz11 8 22382434
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAATTTTACTGCATTGACAAGAAGAAAAGCAGCTGTACTTCAGCTCTG[C/T]AACACTCTGAATGTAAAGCTGGACAATATATCGAACAAGCAGGTAAATGA
Associated Phenotype:
Not determined