Busch Lab

ZMP

si:dkey-1b17.6

Ensembl ID:
ENSDARG00000092874
ZFIN ID:
ZDB-GENE-050208-384
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LVU3]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa13416 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13416
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134478 Nonsense 241 286 4 4
Genomic Location (Zv9):
Chromosome 22 (position 2853880)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1666728
GRCz11 22 1683626
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGACACAATCTCAAGCTTCACATGAGRACTCACACTGGAGAGAGACCTTA[C/A]AAGTGCTCACACTGCGACAASAGATTCAGTAAGTCGGGAAACCTGAAAAC
Associated Phenotype:
Not determined