Busch Lab

ZMP

si:ch211-87h14.4

Ensembl ID:
ENSDARG00000092844
ZFIN ID:
ZDB-GENE-081104-241
Description:
Novel protein similar to H.sapiens CPAMD8, C3 and PZP-like, alpha-2-macroglobulin domain containing
Human Orthologue:
CPAMD8
Human Description:
C3 and PZP-like, alpha-2-macroglobulin domain containing 8 [Source:HGNC Symbol;Acc:23228]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37504 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43829 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43830 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37504
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142419 None None 216 None 5
ENSDART00000143592 Essential Splice Site 57 587 None 13

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 21582140)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21235388
GRCz11 22 21260366
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATGCAAGGCCACACGTACAACAAATCGTTTGAAGTGCAGAAGTACGG[T/G]AAGCATTTATGTATTAATATATACTGTAAAATGTAAATAGAAGTAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43829
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142419 None None 216 None 5
ENSDART00000143592 Essential Splice Site 520 587 None 13

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 21586645)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21239893
GRCz11 22 21264871
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTCCATGGCACTGGGACATCACTAAAGATGCCCGTTTTGCTTTTACGG[T/A]GAGGACATGACTTTCTCCACTTCCCCGTATTGTTTTAAGCTCAGGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43830
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142419 None None 216 None 5
ENSDART00000143592 Nonsense 564 587 12 13

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 21587647)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21240895
GRCz11 22 21265873
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCTGCGTTTCAACCACACACCTCTACCCTGGTGGCAGCTATGCACTCC[C/T]GATCTGGGACACGGTACACATGCTCACAGTGTCTGAAATTTTAAGGTTAA
Associated Phenotype:
Not determined