Busch Lab

ZMP

si:dkey-114d20.1

Ensembl ID:
ENSDARG00000092786
ZFIN ID:
ZDB-GENE-050208-782
Description:
Novel protein containing multiple sushi domains (SCR repeat) [Source:UniProtKB/TrEMBL;Acc:Q1L928]
Human Orthologues:
CFH, CFHR1, CFHR2, CFHR3, CFHR4, CFHR5
Human Descriptions:
complement factor H [Source:HGNC Symbol;Acc:4883]
complement factor H-related 1 [Source:HGNC Symbol;Acc:4888]
complement factor H-related 2 [Source:HGNC Symbol;Acc:4890]
complement factor H-related 3 [Source:HGNC Symbol;Acc:16980]
complement factor H-related 4 [Source:HGNC Symbol;Acc:16979]
complement factor H-related 5 [Source:HGNC Symbol;Acc:24668]
Mouse Orthologues:
AL837518.1, Cfh, Cfhr1, Cfhr2, Gm4788
Mouse Descriptions:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BMW5]
complement component factor h Gene [Source:MGI Symbol;Acc:MGI:88385]
complement factor H-related 1 Gene [Source:MGI Symbol;Acc:MGI:2138169]
complement factor H-related 2 Gene [Source:MGI Symbol;Acc:MGI:3611575]
predicted gene 4788 Gene [Source:MGI Symbol;Acc:MGI:3646434]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1257
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141677 Nonsense 266 344 5 6
Genomic Location (Zv9):
Chromosome 22 (position 24293054)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23579690
GRCz11 22 23606254
KASP Assay ID:
554-1172.1 (used for ordering genotyping assays)
KASP Sequence:
AGGTGCTTTGATAAATACACTATGGATGATCGTCCCTCCTACTCCAGCTA[C/A]ATGACTTGCCAGGATGCAGAATGGACAGGGAAAATTTATTGTTTGAGTAA
Associated Phenotype:
Not determined