Busch Lab

ZMP

si:dkey-61p9.9

Ensembl ID:
ENSDARG00000092759
ZFIN ID:
ZDB-GENE-041210-240
Description:
hypothetical protein LOC558818 [Source:RefSeq peptide;Acc:NP_001038341]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20321 Nonsense Available for shipment Available now
sa6956 Nonsense Mutation detected in F1 DNA Not yet available
sa9408 Nonsense Mutation detected in F1 DNA Not yet available
sa6955 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20321
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131964 Nonsense 536 603 2 2
ENSDART00000144471 Nonsense 99 731 1 9
ENSDART00000148091 None None 258 None 4
Genomic Location (Zv9):
Chromosome 4 (position 61370238)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76249668
GRCz11 4 77631869
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCAAACCCATTTCTTGATTCCTGGAAGAAGCTGACATGGATACTGTCT[A/T]AAAGGTCTCTGTTAAAGCTTCATAAGGCTGCAGTCGAGAAGACTTTACAA
Long Flanking Sequence:
GTCTGTACATCATGTGCCACATCCCTGTCTTCTGCTGGATCTCTCTCACTGTTCTTCAGCCTCTGCTGGCTCAAGAGAGCAATAAAAAAACACCTACAACTCTCACAGGGATGTACATCAACTTCTTACTGTCTCAAAAGCAGCAGATGAGAGAAAAATACAGCAATGATTCTGACCCGGAAGCCAATGCCTGGTCTTTTGCTGACATTGTTCTGAAGCTGGGGAAACTGGCCTTTAAACAGCTGCAGAAAGGCAATCTGATTTTCTACAAAGAAGAACTTGAGGAGTGTGGGCTGGATGTCGAGCAAGCATTTCTGTTCTCTGGGTTATGTACTCGAATGTTTCAGGAGGAAAAAGAAGTTTCAGATGCAAAGGTTTACAGCTTCGTACATCTCAGCGTTCAGGAGTTCCTCGCGGCTCTCTATGTGTTTTATACTTACAAAATCAAGAAAGCAAACCCATTTCTTGATTCCTGGAAGAAGCTGACATGGATACTGTCT[A/T]AAAGGTCTCTGTTAAAGCTTCATAAGGCTGCAGTCGAGAAGACTTTACAAAGCAAGAATGGACACCTGGACCTTTTCCTCCGCTTCCTGCTGGGTCTCTCACTGGAGTCCAATCAGAGTGACCTGGAGGAGCTTCTGCCACGACTGAAGCTCAAAACTGAGAACATCAAACACACGACAGACTATATCAAGAAGAAAATAGAGGAGGAGAAGAGAGGACAATCAGCAGAGAGGACCATCAACCTCTTCCACTGTCTGAATGAACTGAAGGATGACATTGTGGAGGACCTCCAGAAGAGTCTGAGCTCTGGAATTCTTATATCACAGGATCTGTCCTCTGCTCAGTGGTCGGGTCTGGTGTTTGTGCTCCTGATGTCAGAAGAGACTCAAGAGAAGTTTGAACTGCAGAAGTGCAGAAGATCTGATGAAGCACTGATGAGACTGATGCCAGTGGTCAAGAACACCAGGAGAGCACTGTAAGAGTCTTCTTTATAGTATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6956
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131964 None None 603 None 2
ENSDART00000144471 Nonsense 224 731 1 9
ENSDART00000148091 None None 258 None 4
Genomic Location (Zv9):
Chromosome 4 (position 61369862)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76250044
GRCz11 4 77631493
KASP Assay ID:
554-5155.1 (used for ordering genotyping assays)
KASP Sequence:
GGATCTGTCCTCTGCTCAGTGGTCGGGTCTGGWGTTTGTGCTCCTGATGT[C/A]AGAAGAGACTCAAGAGAAGTTTGAACTGCAGAAGTRCAGAAGATCTGATG
Long Flanking Sequence:
TTACAGCTTCGTACATCTCAGCGTTCAGGAGTTCCTCGCGGCTCTCTATGTGTTTTATACTTACAAAATCAAGAAAGCAAACCCATTTCTTGATTCCTGGAAGAAGCTGACATGGATACTGTCTAAAAGGTCTCTGTTAAAGCTTCATAAGGCTGCAGTCGAGAAGACTTTACAAAGCAAGAATGGACACCTGGACCTTTTCCTCCGCTTCCTGCTGGGTCTCTCACTGGAGTCCAATCAGAGTGACCTGGAGGAGCTTCTGCCACGACTGAAGCTCAAAACTGAGAACATCAAACACACGACAGACTATATCAAGAAGAAAATAGAGGAGGAGAAGAGAGGACAATCAGCAGAGAGGACCATCAACCTCTTCCACTGTCTGAATGAACTGAAGGATGACATTGTGGAGGACCTCCAGAAGAGTCTGAGCTCTGGAATTCTTATATCACAGGATCTGTCCTCTGCTCAGTGGTCGGGTCTGGTGTTTGTGCTCCTGATGT[C/A]AGAAGAGACTCAAGAGAAGTTTGAACTGCAGAAGTGCAGAAGATCTGATGAAGCACTGATGAGACTGATGCCAGTGGTCAAGAACACCAGGAGAGCACTGTAAGAGTCTTCTTTATAGTATATGTTGTTAGCTGTTTTGATTGGGTCTGACTTTTACAGAGTGATGTTCATCCTTTTATATTCAATAATCGCTCTGTGTTCATCCTGTCTTTTAACCTTTCCTCTGACTATATGACTGTAATCAGTGGTTTCCTAAGTCATTTGTGCTTCAGTTTATATACCATACCAGATTAACACATTAATACAGTTGTTTATTTTGTCCTCTACACAGGCTACAGTGCTGTAATCTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGTTCTACAATCCTCAAACTGTGTGCTGAGAGAGCTGGACCTGAGTAACAATGCCCTGCAGGATTCAGGAGTGAAGAAGCTCTCTGATGGACTGAAGAGTCAACACTGTAAACTGGAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9408
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131964 None None 603 None 2
ENSDART00000144471 Nonsense 237 731 1 9
ENSDART00000148091 None None 258 None 4
Genomic Location (Zv9):
Chromosome 4 (position 61369824)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76250082
GRCz11 4 77631455
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTCCTGATGTMAGAAGAGACTCAAGAGAAGTTTGAACTGCAGAAGTRC[A/T]GAAGATCTGATGAAGCACTGATGAGACTGATGCCAGTGGTCARRAACACC
Long Flanking Sequence:
CGGCTCTCTATGTGTTTTATACTTACAAAATCAAGAAAGCAAACCCATTTCTTGATTCCTGGAAGAAGCTGACATGGATACTGTCTAAAAGGTCTCTGTTAAAGCTTCATAAGGCTGCAGTCGAGAAGACTTTACAAAGCAAGAATGGACACCTGGACCTTTTCCTCCGCTTCCTGCTGGGTCTCTCACTGGAGTCCAATCAGAGTGACCTGGAGGAGCTTCTGCCACGACTGAAGCTCAAAACTGAGAACATCAAACACACGACAGACTATATCAAGAAGAAAATAGAGGAGGAGAAGAGAGGACAATCAGCAGAGAGGACCATCAACCTCTTCCACTGTCTGAATGAACTGAAGGATGACATTGTGGAGGACCTCCAGAAGAGTCTGAGCTCTGGAATTCTTATATCACAGGATCTGTCCTCTGCTCAGTGGTCGGGTCTGGTGTTTGTGCTCCTGATGTCAGAAGAGACTCAAGAGAAGTTTGAACTGCAGAAGTGC[A/T]GAAGATCTGATGAAGCACTGATGAGACTGATGCCAGTGGTCAAGAACACCAGGAGAGCACTGTAAGAGTCTTCTTTATAGTATATGTTGTTAGCTGTTTTGATTGGGTCTGACTTTTACAGAGTGATGTTCATCCTTTTATATTCAATAATCGCTCTGTGTTCATCCTGTCTTTTAACCTTTCCTCTGACTATATGACTGTAATCAGTGGTTTCCTAAGTCATTTGTGCTTCAGTTTATATACCATACCAGATTAACACATTAATACAGTTGTTTATTTTGTCCTCTACACAGGCTACAGTGCTGTAATCTCACTGTTCAGTGCTGTGAGAGTTTGTCTTCAGTTCTACAATCCTCAAACTGTGTGCTGAGAGAGCTGGACCTGAGTAACAATGCCCTGCAGGATTCAGGAGTGAAGAAGCTCTCTGATGGACTGAAGAGTCAACACTGTAAACTGGAGACACTGAGGTCTGAGTTCGAGCACCTGATTGATTGATTGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26365
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131964 None None 603 None 2
ENSDART00000144471 Essential Splice Site 469 731 6 9
ENSDART00000148091 None None 258 None 4
Genomic Location (Zv9):
Chromosome 4 (position 61368219)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76251687
GRCz11 4 77629850
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTATGATTATGGACTGTGTGATCAATGCCTTACCTTTGTGCTTAAAGA[T/A]GTGTGAAATATAATGATTTAGTTAATATCAGTTCCTTCACCTTTAAAAAG
Long Flanking Sequence:
ACACAGTTTGGTTGATTATAGAGCAGGTACACTGCCTTATACATCTGAACATTTGTACAGAAACAGGAGCACACATTTATAAGACCGAAAACTGACCGCTAGATATGCACAAGAGATTAAGTAAGTAACATTAACTTCTAGTAGTATTGCCAGTGAAAGTAAATGATAAATCACTAGGATTAATCTTAGCCTAGTATTAGGCTCTTCTGGAGTAAGATGTAGCGGAGAAGAATACATTTCTATATTTCTATCTTACTTTAGCCTGCTTTCATGCAACTGCGTTGAGACTAAATTCAGCCAGGCTAGCTTGAAGATCAAGGCTAATCATTTTGTGCAATACGCCGCTAGCTGTGGACAGGGGATTTTGGACTGTTTTTGGATTCTTTATTGTTTGCTGCCTCTTCTGCCTCTTTACTTGATTATGTTTTGGATTAACCCTGTTATTGCTGCCCGTATGATTATGGACTGTGTGATCAATGCCTTACCTTTGTGCTTAAAGA[T/A]GTGTGAAATATAATGATTTAGTTAATATCAGTTCCTTCACCTTTAAAAAGAGCTTAAGATAAATTACTAATGGCATTTAATGTTTCAGTCTTTGGCGTCTAGTGACAATACACAAATACTTAGCTCTTATTTATCTGTACACGTATACTTCACTGCAGTTAAAAGTCTTTCTGTTGAGTTTACTGATGTGTGTGTGTGTTTGTAGATTGTCTGGCTGTATGGTGACAGAGGAAGGCTGTGGTTTTCTGTCTTCAGCTCTGACTTCAAACCCCTCACACCTGAGAGAGCTGGATCTGAGCTACAATCATCCAGGAGATTCAGGAGTCAAGCTGCTCTCTGAACAACTGGAGGATCCAAACTACACACTGGACACACTCAAGTATGTGGGCGAGCATATACATATGTTTTGTTTGGATCTCTCCTCAAAGACAGATGGATAGTATGATGTTTATTTAAACAGCCTGAAGGCAGTTTAATATTTTTTTCACTTTCACAATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6955
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131964 None None 603 None 2
ENSDART00000144471 Nonsense 709 731 9 9
ENSDART00000148091 Nonsense 236 258 4 4
Genomic Location (Zv9):
Chromosome 4 (position 61365104)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76254802
GRCz11 4 77626735
KASP Assay ID:
554-4346.1 (used for ordering genotyping assays)
KASP Sequence:
TGAKCTTCTACAACATCAGTGGAGACACAATGATCCTCATCCACTCAGTC[C/T]AGACCACATTYACTGAGCCGCTCTATCCTGGGTTTWGGGTTTATCGTGGA
Long Flanking Sequence:
ACACACACCCCCAGCTTTGCTGTTATAATGTGTGTGTCTTCTTGTGTTCAGATGCCTGTTTCCTCACACTGGACCCAAACACAGCATACGCTGAACTCATTCTGTCTGAGGAGAACAGGAAAGTGATGAATGTGGATCAGAAACAGCCGTATCCTGATCATCCAGACAGATTCGATAATGTACTGCAGGTGTTGTGCAGAGAGAGTGTGTGTGGACGCTGCTACTGGGAGATTGACTGGACTGGAGAGGATGCGTCTACATCAGTGGCATATAAGAGCATCAGGAGGAAGGGAGATATTGAGTGTGCGTTTGGATGGAATCCTCAGTCCTGGAGTTTGATCTGCTATTCCTCCAGCTACGAATTCAGACACAATAACAAACATACCTATTTACCAGGAGAGCCGATCAGCAGGAGGATAGGAGTGTATCTGGATCACAGAGCAGGAACTCTGAGCTTCTACAACATCAGTGGAGACACAATGATCCTCATCCACTCAGTC[C/T]AGACCACATTCACTGAGCCGCTCTATCCTGGGTTTAGGGTTTATCGTGGATCTTCAGTCAAACTGTGCTGAAGACTGAGAGATTGAGGACTGGACTTATTTACCCATAATCCTGTGCTCTGCAGGATCATTCAGCAGCAGTGAGATGTTCTGGAGTCTCTTCATCGCATTATTCCTGAACTTAAGTGTGTGTGTGTGTTTGAGTGGTATTCTCCTTTTGTCTTTCTTCATTTACTATCATAATAAAACTGAACTGTCCTCTAGTTTACACTGCACATCTGTATCATTACTGTAATAATGATCATCTCAAACACATTCACTCAAAACAGGGACAGACAGGAGCATGCAGATAACCCAAAAGCATAGTCAGAGTACAGGCGAGTGGTCGAGACAGGCAGCAAAACAACATAAACAGTAAAACAAAGCAAAGGTCAAAAGTGGAACAAGGCAAGATCAGGAAAACGCTTCAGTAATGCTCACTTGCCGATCACAGGACTCAGC
Associated Phenotype:
Not determined