Busch Lab

ZMP

si:dkey-40m6.8

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42764 Nonsense Mutation detected in F1 DNA Not yet available
sa11927 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42764
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134459 None None 339 None 6
ENSDART00000147981 Nonsense 175 234 5 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34378732)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32110232
GRCz11 16 32064262
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTATCAGGCAGTGGTGAAGGAGCTGAGGGTCAGTGCTAGTCCTCTGGAA[C/T]AGCGGAAGTTCCTGGCAGAGTCCGAGCCATACAGGTCAGACAAACTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11927
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134459 Nonsense 267 339 4 6
ENSDART00000147981 None None 234 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34392095)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32123595
GRCz11 16 32077625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACCGTRACCGTGGGAGGAATGTGTCATTTTTCGATGACGTCACAGTCTA[T/A]MTTTTCGATCAGGTATGTCAAGGGTGTTTATACAAGCATCTTCAATTACG
Associated Phenotype:
Not determined