Busch Lab

ZMP

taar13a

Ensembl ID:
ENSDARG00000092734
ZFIN IDs:
ZDB-GENE-041014-68, ZDB-GENE-070424-256
Description:
trace amine associated receptor 64 [Source:RefSeq peptide;Acc:NP_001076571]
Mouse Orthologue:
Taar4
Mouse Description:
trace amine-associated receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2685072]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45717 Nonsense Mutation detected in F1 DNA Not yet available
sa37149 Nonsense Mutation detected in F1 DNA Not yet available
sa4926 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa45717
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140951 Nonsense 113 341 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46148789)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46273184
GRCz11 20 46176904
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTGGTACTATGGAGAGACCTTCTGTATGCTTCACTCAACTTTTGACT[T/A]GTTCCTCACATCAGTGTCTATTTTGCATCTTGTTTGTATTGCTGTTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37149
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140951 Nonsense 139 341 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46148712)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46273261
GRCz11 20 46176981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTTGTTTGTATTGCTGTTGATCGACATCAGGCTGTATGTTATCCGCTT[C/T]AGTACCCAACAAGAATAACCATATCTGTTGCATGGGTCATGGTGATGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4926
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140951 Nonsense 326 341 1 1

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 46148151)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46273822
GRCz11 20 46177542
KASP Assay ID:
554-3551.1 (used for ordering genotyping assays)
KASP Sequence:
ATGGCTTTTTCTACCCATGGTTTAGAAAAACCCTTTATCTCATTATAACA[A/T]GAAGAATATTTGAACCAAACTCATCTGATATCAATGTTTTCACTGTGTAA
Associated Phenotype:
Not determined