Busch Lab

ZMP

si:ch211-86k6.5

Ensembl ID:
ENSDARG00000092678
ZFIN ID:
ZDB-GENE-091204-170
Human Orthologue:
AKNA
Human Description:
AT-hook transcription factor [Source:HGNC Symbol;Acc:24108]
Mouse Orthologue:
Akna
Mouse Description:
AT-hook transcription factor Gene [Source:MGI Symbol;Acc:MGI:2140340]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43602 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43602
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139041 Nonsense 30 237 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12135946)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13837120
GRCz11 21 13933849
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAATCAGCAACTCCGCTCTCACAGAAGCCCCTCCCTCCACAGGCCTTA[T/A]CACCACAGTTCTGCTCAGCTAACAAATCACCAGTGAGTTTCCTAAAGGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29544
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139041 Nonsense 177 237 4 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12131280)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13832454
GRCz11 21 13929183
KASP Assay ID:
2261-5373.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCAGTGTCGCCTGTGAAATCAAGAGGAAGAAGACAAACCAGGAGATTT[G/T]AATGTCACAAAGAGGATAGTACATGTAAGAAAATATTTAATACAATTTTA
Associated Phenotype:
Not determined