Busch Lab

ZMP

si:dkey-57a22.11

Ensembl ID:
ENSDARG00000092651
ZFIN ID:
ZDB-GENE-081104-423
Description:
hypothetical protein LOC569865 [Source:RefSeq peptide;Acc:NP_001116771]
Human Orthologue:
SGOL1
Human Description:
shugoshin-like 1 (S. pombe) [Source:HGNC Symbol;Acc:25088]
Mouse Orthologue:
Sgol1
Mouse Description:
shugoshin-like 1 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1919665]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3704
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135032 Nonsense 693 847 6 8
Genomic Location (Zv9):
Chromosome 9 (position 23014369)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 22170155
GRCz11 9 21981024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAATACGGCCWGTGRAGAAATGGCTGATGCTGCGTTTTCCATTTTTGAA[C/T]AGGATCATCTCTCTAATAAAACAGATGTTTCTTCTGTAAAGAGCACTAGT
Associated Phenotype:
Not determined