Busch Lab

ZMP

si:ch73-92e7.3

Ensembl ID:
ENSDARG00000092605
ZFIN IDs:
ZDB-GENE-080219-42, ZDB-GENE-081030-5
Description:
Novel protein (Zgc:174712) [Source:UniProtKB/TrEMBL;Acc:B8JM00]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37400 Nonsense Mutation detected in F1 DNA Not yet available
sa3164 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29692
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134277 Nonsense 53 336 3 4
Genomic Location (Zv9):
Chromosome 22 (position 1768372)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2509462
GRCz11 22 2525728
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAAGTGAAGAAGAAACTCAATCAGAGCCTGAACATTTATTTTCTCTA[C/T]AAACAAACACAAACAACAATCACAGTAAGTAGGAGATTTTAAGATCCAGC
Long Flanking Sequence:
AGAACTGGTTCTCAATTGACTTACCTGGTTAAATAAAGGGGTTTTATAATATGCTTTATTTCATCATTCAGTGTAAATTAATCAGATTTTTCTGTTTTTCTTTTGCAGCTCGTCCTCCTACAGTGCAGCTGTAAATACTGAAATATCCCCATCAGTTTACAAGTGAAGACGAGCATCAGACCATCAGGAAGAAGAGAAATCTGCAAAGACAGAGTTTATTGAAGGACAGTGAGAAGATGAGTGATCCAGAACCCTGCAGAATTAAACAGGAAGAGACTGAAGAACTAATAGGTTTGTGTTTATTCATTACTCTTTTGGTGCAAGCCATATATATATAGTAGTCAACATTTAGCAAACGATTAATAACTCGTCTCTTAAAATGAACTTATTGATTTTCAGATGTGAAGGAGGAGAGTGAAGAACTGAGTGAAGATGAGGAGAAATATCATGTCAAAAGTGAAGAAGAAACTCAATCAGAGCCTGAACATTTATTTTCTCTA[C/T]AAACAAACACAAACAACAATCACAGTAAGTAGGAGATTTTAAGATCCAGCCCTTCAGGTCATATTATTTAGGATAATCATGGAATTTAATTGTCTCTGTTGTTTTCTCGTCTTTCTTCCAACAATGTTTTTAAGCCACTTGAATTTGGATTGTGTAAATTTCACAGCAAACTGCATTAGTTAAAGTCACTAATATCCTGCTAATGGCCTCCAATTCTGGACATCTGTTTAAACAGACACTTCTCTATCTTACTGATGCTTTCGCCACTATAGACCACATTTGAACTAGGGTTGTGCCGATAGACGATGCCATCCTCCATCGCCGAAGGCCGACAAACTTCACGATGCTGAGCCAGCATCGTGATCCATTGCCTCGCCCCACATTTATATTGATATATAACTTATTATTTGCATGTCATCTTAATAGCAATAACGGTCTTTTCATGAGCTGTGTTAAATTTTACATATAGCTGCTGCTTGCACATCTGACAGCATCGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37400
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134277 Nonsense 146 336 4 4
Genomic Location (Zv9):
Chromosome 22 (position 1771616)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2512706
GRCz11 22 2528972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCTTAATCAACACATGAAGATCCACACTGGAGAGAGACCACACTATTG[T/A]GATCAATGCGGCAGAACATTTTTGAGGACTTCAGAACTGAGGAGACATCT
Long Flanking Sequence:
ATTGTCTATCGGCCCAACCCTAGTATCCTCTCTTTCCGCTCAATGTTGATCCATATTTATAGCCGATTTGCAAATAGCGCAACTCGCTGCAGGTTCACAACGGCGGACTCAAGGAAACAAACAGTGAGTGATGTCATGGCACACACAAGTACAGACAGGCAACAGCCGTGTAACACAAGGACAATACAGTTTTACTGCTATTCACTACTTAAGATGTAACTTTGTTTCTGTACTTAATTTTCAGACCTGATGGTGACGAAAGAGGAAAGCGAAGAACTGAGTGTAGACAAGGTCCATCATAGTGTTCATACAGAAGTGAAGCCAAATTCATGTACTTTGTGTGGAAAGAGTTATAAACAGCCGTCACATTTACAACAACACCAGAAGATTCACACTGGAGAGAGACCGTACACATGTGATCAATGTGGGAAGCGTTTCAGACGATCATCAACCCTTAATCAACACATGAAGATCCACACTGGAGAGAGACCACACTATTG[T/A]GATCAATGCGGCAGAACATTTTTGAGGACTTCAGAACTGAGGAGACATCTTACAGTTCATACAAACGAGAAGCCTTACTCATGCTCTGAGTGTGGAAAGAGTTTTAGTCGTCTGTCAAATCTAAAAGTACATCAGAAGATCCACGCTGGGGTTAAAGAGCATGTGTGCATTGAGTGTGGGAAGAGTTTTATTAATGCACAAGTACTGCAAATACACCAGAGGATCCACACCGGAGAGAAACCGTACAAGTGTTCACACTGCGACAAGAGATTCAGTCTGTTACACTCTCTGAAATCACACGAGAGGATTCACACTGGAGAGAAACCTTACACATGTACTGGGTGTGGAAAGAGTTTCAAAAATTCATCACAACTTCGTCAACACATGATGATCCACACGCGAGTGAAAACGCACAAATGTGATCAATGCGGCAAAGCGTTTTTGAGGCCTTCACATCTGAAGAACCATCTTACAGTTCATACAAAAGAGAAATCAAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3164
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134277 Nonsense 219 336 4 4
Genomic Location (Zv9):
Chromosome 22 (position 1771833)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2512923
GRCz11 22 2529189
KASP Assay ID:
554-2719.1 (used for ordering genotyping assays)
KASP Sequence:
GCATTGAGTGTGGGAAGAGTTTTATTAATGCACAAGTACTGCAAATACAC[C/T]AGAGGATCCACACCGGAGAGAAACCGTACAAGTGTTCACACTGCGACAAG
Long Flanking Sequence:
AACTTTGTTTCTGTACTTAATTTTCAGACCTGATGGTGACGAAAGAGGAAAGCGAAGAACTGAGTGTAGACAAGGTCCATCATAGTGTTCATACAGAAGTGAAGCCAAATTCATGTACTTTGTGTGGAAAGAGTTATAAACAGCCGTCACATTTACAACAACACCAGAAGATTCACACTGGAGAGAGACCGTACACATGTGATCAATGTGGGAAGCGTTTCAGACGATCATCAACCCTTAATCAACACATGAAGATCCACACTGGAGAGAGACCACACTATTGTGATCAATGCGGCAGAACATTTTTGAGGACTTCAGAACTGAGGAGACATCTTACAGTTCATACAAACGAGAAGCCTTACTCATGCTCTGAGTGTGGAAAGAGTTTTAGTCGTCTGTCAAATCTAAAAGTACATCAGAAGATCCACGCTGGGGTTAAAGAGCATGTGTGCATTGAGTGTGGGAAGAGTTTTATTAATGCACAAGTACTGCAAATACAC[C/T]AGAGGATCCACACCGGAGAGAAACCGTACAAGTGTTCACACTGCGACAAGAGATTCAGTCTGTTACACTCTCTGAAATCACACGAGAGGATTCACACTGGAGAGAAACCTTACACATGTACTGGGTGTGGAAAGAGTTTCAAAAATTCATCACAACTTCGTCAACACATGATGATCCACACGCGAGTGAAAACGCACAAATGTGATCAATGCGGCAAAGCGTTTTTGAGGCCTTCACATCTGAAGAACCATCTTACAGTTCATACAAAAGAGAAATCAAGTTCTTTAGCTCCTTCAGAAATGTTCTCAGCTCCTCTACAAGGATTTCCAAATGATTTTTCCTGTTTTCATTCATGAGATAACTCAGGCAAAAAACAGTCAGTTTCTGTGTACATCCCTTCACCAGTAAGTCCCCGGCATACTTTAAACAAAACTGAAGAACAAACTGAAAAATCCATCTGATACTGAGTTAATTTTCAGTTTACTGTAGAAGTTCGAATC
Associated Phenotype:
Not determined