Busch Lab

ZMP

si:dkey-60a16.3

Ensembl ID:
ENSDARG00000092503
ZFIN ID:
ZDB-GENE-030131-4459
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RGW7]
Human Orthologue:
ARID1B
Human Description:
AT rich interactive domain 1B (SWI1-like) [Source:HGNC Symbol;Acc:18040]
Mouse Orthologue:
Arid1b
Mouse Description:
AT rich interactive domain 1B (SWI-like) Gene [Source:MGI Symbol;Acc:MGI:1926129]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa8523 Nonsense Mutation detected in F1 DNA Not yet available
sa43376 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8523
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138818 Nonsense 126 1840 2 20
Genomic Location (Zv9):
Chromosome 20 (position 5081485)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4996852
GRCz11 20 5039765
KASP Assay ID:
2261-3924.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCAGATGTATGGGATGGGCAACARTCCCTAYTCYCAGCAAGGAACTTA[T/A]GCCGGACAGCCATACGGATCACCCACTGCTCACCGATATCCAATGGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43376
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138818 Nonsense 777 1840 13 20
Genomic Location (Zv9):
Chromosome 20 (position 4960623)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4875990
GRCz11 20 4918903
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGGAGAAGAACCTCCACCTGATGCGTTCGCTATGGGCGATGGCAAGAAG[C/T]AGCAACAGCAAGCCAAGATCCAGCCACCATCGCCTGGTAAAACATTTTTT
Associated Phenotype:
Not determined