Busch Lab

ZMP

Q5RII8_DANRE

Ensembl ID:
ENSDARG00000092484
Description:
Novel protein similar to human MDN1, midasin homolog (Yeast) (MDN1) [Source:UniProtKB/TrEMBL;Acc:Q5R
Human Orthologue:
MDN1
Human Description:
MDN1, midasin homolog (yeast) [Source:HGNC Symbol;Acc:18302]
Mouse Orthologue:
Mdn1
Mouse Description:
midasin homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1926159]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa23694 Nonsense Available for shipment Available now
sa25134 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43434 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31044 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37021 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa29353 Nonsense Mutation detected in F1 DNA Not yet available
sa1349 Nonsense Available for shipment Available now
sa8598 Nonsense Mutation detected in F1 DNA Not yet available
sa23693 Essential Splice Site Available for shipment Available now
sa6631 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa23694
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Nonsense 115 2198 1 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23880795)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23999596
GRCz11 20 23898696
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCTTTATCCTGATGTGGTGGTGCCTCTGCGGGCAGCTATTTTGCAGGTG[C/T]AGCATGGGATGCGACTCCTGGCTTCTCAGGTGTCCTTTTCAACGACTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25134
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Essential Splice Site 668 2198 None 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23875882)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23994683
GRCz11 20 23893783
KASP Assay ID:
554-7375.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTCTAATCAACTAAATGTTTTAAAAATTATACCATTCTATCTGTGGTC[A/G]GGACCCTGTTTAAGTTTGTGAAGAAGTTTGAAGCGGCACTGAAGGAGCCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1452
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Nonsense 688 2198 11 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23875820)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23994621
GRCz11 20 23893721
KASP Assay ID:
554-1378.1 (used for ordering genotyping assays)
KASP Sequence:
AAGTTTGTGAAGAAGTTTGAAGCGGCACTGAAGGAGCCGTGTGCACCGTG[T/A]CTGGTGGAGCAGGGCAGTAGCAGCAGCATGGATGATGTGGATTCACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43434
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Essential Splice Site 829 2198 None 38
ENSDART00000143005 Essential Splice Site 829 2198 None 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23874702)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23993503
GRCz11 20 23892603
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAAACAGAGAGCACTGGCTGATCTCTTCAAGATGCTTGCACAGATAGG[T/C]CAGTCTGAGTTGCTTCTTCTGGTTTTAGAAACCTTGTTTAGAAATACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31044
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Essential Splice Site 829 2198 None 38
ENSDART00000143005 Essential Splice Site 829 2198 None 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23874702)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23993503
GRCz11 20 23892603
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAAACAGAGAGCACTGGCTGATCTCTTCAAGATGCTTGCACAGATAGG[T/C]CAGTCTGAGTTGCTTCTTCTGGTTTTAGAAACCTTGTTTAGAAATACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37021
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Essential Splice Site 1085 2198 None 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23872303)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23991104
GRCz11 20 23890204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTGGATGGACTGGCGGAGGAGTCCACAGAAAGAGCTATTTGTAGTTGG[T/C]AAGACCGAATAATATTTTACACTCTGTCTGTTCAGTTATTGAGTTGTGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4113
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Nonsense 1160 2198 18 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23871392)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23990193
GRCz11 20 23889293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTCACCACCTGGAAAACCCAACTTCTCTCTATCAGACAGTCACAGAAA[C/T]GTAAGAACACATATTAAAATAGAATAAGAATAAAATACTGATNNAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29353
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Nonsense 1170 2198 19 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23870802)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23989603
GRCz11 20 23888703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTTATGTTTTTTTATAGAGAGTGACTCAGAGGTAGTGGAGGAGCTCT[T/G]AAAACCAGGACACTTGAGCAGGTTGCTGGAAGAGGAACTGAGTGGAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1349
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Nonsense 1245 2198 20 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23870485)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23989286
GRCz11 20 23888386
KASP Assay ID:
554-1263.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCGTTTGGAGCCCATGCTGTGTCTCTACTCTGAATTGGTGAGGTATTA[T/A]CTTGCTGTGCTGATGGGGGCTCACCGTACCACYGGAAAGCTTTTGTCCGT
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control on top; Mutant below; 5 dpf
Control on top; Mutant below; 5 dpf
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
gut
ZFA:0000112
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084
increased size
PATO:0000586
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa8598
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Nonsense 1804 2198 29 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23865043)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23983844
GRCz11 20 23882944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGATGARGAAGATGAYATYGCGATGGAAGTGGARGAAGAGAAGGAYCTA[C/T]AAGCAGTTGAAGCCCAGGAGCTTAAACCAGAGAAGCTAAATGACAATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23693
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Essential Splice Site 1908 2198 None 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23863658)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23982459
GRCz11 20 23881559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGCTTAAATGTGTGTGTATTTATTTGTGTGTTTTGCTGTTGTCCCTC[A/C]GGAGAGTGCTGCTGCAGCGTTGTGGCATCAGTACCAGACCCTGACATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6631
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Nonsense 1974 2198 33 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23862978)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23981779
GRCz11 20 23880879
KASP Assay ID:
554-4560.1 (used for ordering genotyping assays)
KASP Sequence:
GCGGAAAGTTATTCCCTACATTGCCAGTCAGTTCCGCAAGGATAAGATCT[G/A]GCTGAGGAGAACAAAACCCAGCAAGAGGAAYTACCAGATCTGCCTGGCTG
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
gut
ZFA:0000112
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084
increased size
PATO:0000586
abnormal
PATO:0000460

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29352
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143005 Nonsense 2081 2198 36 38

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 23861547)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23980348
GRCz11 20 23879448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATCTTTCAGTTTTTAGAGACATCAACAAACATGTTCATGGCAGCCAAA[C/T]AGCAGATCCCTGGTGCGACAAACACTGGTAAAATAAATTACATGTTATAC
Associated Phenotype:
Not determined