Busch Lab

ZMP

si:dkey-173l11.3

Ensembl ID:
ENSDARG00000092450
ZFIN ID:
ZDB-GENE-081104-9

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa41031 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14895 Nonsense Available for shipment Available now
sa1461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41031
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044592 Essential Splice Site 74 405 2 8
Genomic Location (Zv9):
Chromosome 7 (position 56117914)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52936596
GRCz11 7 53206248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTAAAGTCCACAAAGATCACCTTCACAAAGGAGAGAGACTCGGGAGAGG[T/A]AAGCGGTGTACTTCTAATTATACTAAAGAAGCAGCTAAACATTGAGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14895
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044592 Nonsense 149 405 3 8
Genomic Location (Zv9):
Chromosome 7 (position 56115437)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52939073
GRCz11 7 53208725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCAGAGTTGAGCGTGTCGATTATCATAAGGATCATGACGTRAATACAT[T/A]AATGAATACTTCCTCTGTACAGGTATAGATATTACTTCCTAAAACTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1461
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044592 Nonsense 235 405 5 8
Genomic Location (Zv9):
Chromosome 7 (position 56114714)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52939796
GRCz11 7 53209448
KASP Assay ID:
554-1386.1 (used for ordering genotyping assays)
KASP Sequence:
TCACTGGTGAAGGAGCAGATCAGGACCCTAAGGGAATTTTTCAAATAGAC[A/T]GACTATCAGGATGGGTCAGTGTAACTCAGCAACTTGACAGAGAAAAAAAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461