Busch Lab

ZMP

si:dkey-79p17.3

Ensembl ID:
ENSDARG00000092404
ZFIN ID:
ZDB-GENE-081105-132
Description:
Novel protein similar to vertebrate lactase (LCT) [Source:UniProtKB/TrEMBL;Acc:B0UYB9]
Human Orthologue:
LCT
Human Description:
lactase [Source:HGNC Symbol;Acc:6530]
Mouse Orthologue:
Lct
Mouse Description:
lactase Gene [Source:MGI Symbol;Acc:MGI:104576]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38764 Nonsense Mutation detected in F1 DNA Not yet available
sa27482 Nonsense Mutation detected in F1 DNA Not yet available
sa38763 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38764
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145110 Nonsense 298 1592 2 12
ENSDART00000145931 Nonsense 604 1898 7 17
Genomic Location (Zv9):
Chromosome 9 (position 47594313)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46593116
GRCz11 9 46393595
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTCATGCTGGGGTGGTTTGCTCATCCAATATTTGTAGATGGAGATTA[T/A]CCAGCGGTACTGAGGGAGCAAATTGAGAAAAAGAAAGAATTGTGTACCCA
Long Flanking Sequence:
GCCGAACGACCTGGCCATGAAAGTGCCTTCACTTTCATGGCCTTCACCTAGCAAAAGATGTACACACAACAGCGACTTTATGACACAACCATACCAGGGATCTGAGGGATTTAGTGAACACAAGATAGTGTGAACACAAACCAGCCGAGAGGGTGGCAAGAGGGAGCAATCAAACTTGGGTTTGGACCAGGCAATCGAACCAAGTGTGAAAGCACCCTTAGAAAGTCCCAAATATAGTATGATTTTAAAAAGTGTATACTGACAATTCTTTGCTTGTATTCACAGGTGACGCACAATATTCTGAAATCTCATGCTGAAGCCTGGCATATTTATAATGATAAATACAGGAAACTGTATGGTGGAAAAGTGGGCATTGCTCTGAACTCAGATTGGGCTGAGCCGAGGGATCCCTCAAGTGATCAGGATGTAGCAGCAGCTGAGCGTTATCTAAACTTCATGCTGGGGTGGTTTGCTCATCCAATATTTGTAGATGGAGATTA[T/A]CCAGCGGTACTGAGGGAGCAAATTGAGAAAAAGAAAGAATTGTGTACCCAAGACCTGGCAAGACTCCCTGTCTTCACCGAGGCTGAGAAACAAAGAATTCGAGGCACAGCTGATTTCTTCGGACTAAACCACCAAACATCCCGACTGATTAGTGAGAATTTGACTAGCTGTGATGCTGGGCCAGATAATGTTGGGGACTTCCAGGCTCATATTGACCCTACATGGCCCACTACAGCTTCTGACCAGATCCAGTCTGTTCCATGGGGGCTCCGGCGGTTATTGTATTACATCTTTTTAGAGTACACATCTATTACAAAGGTGCCCATCTATATCACAGGAAATGGAATGCCAACTGAGTATACTGGTGACGGGATCAATGACACTCTGCGTGTTGACTATCTCAAAGCTTACATTAATGAAGCAATGAAAGGTAAGAGTAAAAGGTCAAAAAAAGGGTCTTTTACTATTGCATTTTAACACTAAATGCTGCCATGAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27482
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145110 Nonsense 710 1592 3 12
ENSDART00000145931 Nonsense 1016 1898 8 17
Genomic Location (Zv9):
Chromosome 9 (position 47592942)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46591745
GRCz11 9 46392224
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATGGTTAGCATATTCAATGAATATTGTGACTTCTGCTATGCAACATTT[G/T]GAGATAGGGTGAAGTTTTGGATCACCTTTAATGAACCCCAGACGATTGCA
Long Flanking Sequence:
AGTTTTCACCTCAGACCAAATTTGAGAGGCAGCTTTATCACTATGGAACATTTTCAGAGGGATTTCAGTGGGGTGTCTCATCTTCAGCTTATCAAGTTGAAGGTGGCTGGAATGCAGATGGAAAAGGACCAAGTGTTTGGGATACTTTCACTCAGAAACCTGGTAATATCCCAAACAATGCCAATGGCGATGTTGCATGTGATAGCTACAATAAAGTAGATGAAGATCTACACATGTTGAGGGCCCTAAAAGTGAAGACTTACAGATTCTCATTGTCATGGTCTCGGATCTTTCCAAATGGCTATAAATCTTCTCTTAACCAGAAGGGGGTGGATTACTACAACAGGCTCATAGATGGTCTCATAGCAAATAATATCACACCCATGGTGACTCTCTACCATTGGGACCTGCCGCAGGCTTTACAGAATATCAATGGTTGGGACAACACTGAAATGGTTAGCATATTCAATGAATATTGTGACTTCTGCTATGCAACATTT[G/T]GAGATAGGGTGAAGTTTTGGATCACCTTTAATGAACCCCAGACGATTGCATGGTTGGGATATGGGCTGGGTCAGATTCCACCTAATGTGAAGCAACCAGGAGATGCTCCATACAGGGTTGCACACAACCTCCTGAAAGCTCATGCACAAGCTTATCACACATATGATGAGAAATACAGGGCATCTCAAGGAGGTCTGGTATCCATTAGTCTGAATGCTGAATGGGCAGAACCCCTGGATGTCAACATCCCTCGAGAGGTGGAGGCTGCTGATCGAGCTCTTCAATTTCAATTAGGCTGGTTTGCACATCCAATCTTCAAGAATGGTGACTACCCTGATGCCATGAAGTGGCAAGTTGGCAACAAGAGTGAACTGCAAGGCTTAAAAGAATCCCGGTTACCTTCTTTTACTAGCCAAGACAAAGCTTTTATCCAAGGAACAGCTGATGTATTCTGCATTAACACATACACTACGAAAGTCATGCGCCATGTGACCAGCAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5571
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145110 Nonsense 1092 1592 5 12
ENSDART00000145931 Nonsense 1398 1898 10 17
Genomic Location (Zv9):
Chromosome 9 (position 47591624)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46590427
GRCz11 9 46390906
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAACGCAAGATGATAATGGTGACATTGCCTGTGACAGCTACAACAAGATC[G/T]AAGAGGATATCAATGTTCTCAAAACACTTGGGGTCAAACATTATCGGTTT
Long Flanking Sequence:
ACTTATATGTGCTCTATTTTTAGCGCACAACCTGGATGGAGTACGTGTTAAAGGATACATTGCTAGTTCACTCATGGACTCCTTTGAGTGGCTGAATGGCTACAATGTCGGCTATGGACTTCACCATGTGGACTTTAAGCATTCAAGTCGGCCAAGAACCCCAAAGCGCTCAGCTCACTTTTACTTCGATATAATAAGAAATAACGGCTTTCCAATCACAGCAGAGGAAGAAATACTATATGGACATTTCAGAGAAGGATTTGAATGGAGCACAGCAACCGCTGCATATCAGGTACAATCCATTTCTTCTTGTTTTTATTAGCATTTCTTCACTCAGAGTATGAGGGTAATGCTCATGCTTTGCTGCATCACCACAGATAGAGGGCGCCTGGAGAGCTGACGGAAAAGGCCTAAGCATTTGGGACAAATTTTCACACACTGATTCAAAGATAACGCAAGATGATAATGGTGACATTGCCTGTGACAGCTACAACAAGATC[G/T]AAGAGGATATCAATGTTCTCAAAACACTTGGGGTCAAACATTATCGGTTTTCTATTTCATGGCCCAGAATTCTGCCAGATGGAACAAACAGGAAAATTAATGAGGCTGGGCTCGACTACTATCATAGACTGACAGATGCTCTTTTGGCAGCCAATATCAAGCCACAGGTAAATTATTTCAAAACAATTTGAATGAAAAAAACCTATTTTGGTCATTTCTGACAGTCTATTGATCACTGGCAGGTGACACTTTACCACTGGGATCTGCCACAAGCTCTTCAGGATGTTGGTGGTTGGGAGAATGACACTATTGTTGATAGATTCAGAGACTATGCTGATGTTGTATTTAACAGTCTGGGTGAAAAAATAAAGTTTTGGATCACTTTAAATGAACCCCTAAATGTTGCAGCACATGGATATGGCTATGGAAGCCAAGCACCAGGTATCATTAGCATTAAAAATAACCTTTTCCTGTAATAAAAGTTGCTTAGCTTAACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38763
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145110 Essential Splice Site 1361 1592 10 12
ENSDART00000145931 Essential Splice Site 1667 1898 15 17
Genomic Location (Zv9):
Chromosome 9 (position 47590427)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46589230
GRCz11 9 46389709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATGTTTCTGAATTCAAGCATCAGGATTCAAAAAGTTGCCATTTATTCC[A/T]GGGGTGCTGGAGCTATTAGGGATCGTACATGGCTAGATTCTGGATCCATC
Long Flanking Sequence:
AAACAAGAAGACGTGGATGCTGCCAGACGTACGATTCAGGTACAGCTTTGTTGTACAGCGATATCTACATTAATTTCTACATGCCACTTCACTTTTTATCTCTTTTAAACAGTTTCAGCTTGGTTGGTTTGCTCATCCCGTGTTCAAAGGAGATTACAGTGATTTAATGAAGGATGTTATTCGAGAAAGAAGTTTGGCAGCTGGCCTACCTAAATCAAGGTAAATACAGACATTTTCTTGTGAGGAATTCACAACTTTGCATGCTTCTAAATGCCTTTACATTTGACAGGCTTCCAGAATTTACCCCTGAAGAAGTAGCAAGAATTAAGGGTACTCATGATTATTTTGGATTCAACCACTACACCTCTGTTTTAGCCTTTAACGTGGACTACGGTGATCAACAGCACATTGAAGCAGACAGGTAACCCTTTAGTTTGAGATGTTTTAGGTCCATGTTTCTGAATTCAAGCATCAGGATTCAAAAAGTTGCCATTTATTCC[A/T]GGGGTGCTGGAGCTATTAGGGATCGTACATGGCTAGATTCTGGATCCATCTGGTTGAAAGTAGCTCCTGTGGGATTCCGAAAGATTCTGAATTTCATTAAGGAGGAATATGGAAACCCTCCTCTTTACATTACAGAAAATGGAGTATCAGAACAAGGACCAGAGAATCTGAATGACGTCACCCGAATCTACTACTATGAAAACTATATCAATCAGGCCCTGAAAGGTAAAGATCTTTCCTCTTAAAGATGTCAAAAGGAACATTATTAAATGATTGTTTGCTATAATAGTTTTGCATGTATTTTTTTGTTTAGCATTTTCAGTTATTTGGTGCTAATTGCAGTGTTATTCTTAGCATATATGCTAGATGGTGTGGACATCCGCGGCTACACTGCCTGGTCACTAATGGACAATATGGAATGGGCAGCGGGTTATACTGAAAGATTTGGTCTTTTCTATGTAAATCGGTCAGATCCCAATTTTCCACGTATTCCTAAGAAA
Associated Phenotype:
Not determined