Busch Lab

ZMP

si:dkey-26i13.7

Ensembl ID:
ENSDARG00000092242
ZFIN ID:
ZDB-GENE-090312-214
Human Orthologue:
CHST12
Human Description:
carbohydrate (chondroitin 4) sulfotransferase 12 [Source:HGNC Symbol;Acc:17423]
Mouse Orthologue:
Chst12
Mouse Description:
carbohydrate sulfotransferase 12 Gene [Source:MGI Symbol;Acc:MGI:1929064]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18689 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3362
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140725 Nonsense 97 343 1 1
Genomic Location (Zv9):
Chromosome 1 (position 10777662)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10909739
GRCz11 1 11596539
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCTGCACCATCTCATTGTGGACGATCATCACCGTGTGATTTACTGTTA[T/A]GTACCCAAGGTAGCTTGTACTAACTGGAAAMGAGTCATGTTTGYCCTCAG
Long Flanking Sequence:
CAAACTAATTGGTTCATGATCATCCTAAAGCGTACATGTACAAGCATGTTTATGGATTATGTTAATGGTAAATTGAGACTTCAGCAAACTTGTTCTTATTTTTCATTAAACTTTTTTTCCTGCAGATTTGTCAACTGGATTCTTTCCTGAGATAAATAATATTTACCACAAGTTCTAAGAATCTGGTGTAGACTATTGTCAAGAATCAGAATGCAGAAGCTCCATCAGCGTTGTTTACTTTTGGGAGCAGTATTCATCACAATGTTTTTTATTGTAGTTTTCTGGGATGAGGTGAGAGTTGGGCCTAACCACAGGGCTTCATCAAAACATCTTGCACAGTTTAAACTGCGTCAAGCACATCGTAAGCATCTAATAAAAGAGCTTTGCTCAGCCAATAGAAGCTTGAATTACAGACAGAAATCATTCACATTTGACCAGATTCCCAACAAAGCTCTGCACCATCTCATTGTGGACGATCATCACCGTGTGATTTACTGTTA[T/A]GTACCCAAGGTAGCTTGTACTAACTGGAAACGAGTCATGTTTGCCCTCAGCCAGAACCTGAAGGCACCTGATGGAGCTCCATATCTGGATCTTCTTGACATACCATTAGAGATAATCCATAATTCTACAGTGCATAAGACATTTAGCAAGTTATGGATGCGTCATGGCCGATACGCTCGTCCTCTGATGCATCACAAGCTGAAGAACTACACTAAGTTCCTCTTTGTGCGGGATCCTTTTGTGCGCCTTATTTCTGCTTATCGAGACAAGCTTATGAAGCCAGATGAGTACTTCTACACCCATTATGGCTCCACAATGCTTCAGCGTTATGCTAATATTTCTCAGCCCCCTGATTCGGCTCAAGAGGCCTTCAGAGCAGGTATCAGACCATCCTTCATTCACTTTATTCAGTATCTGCTAGATCCAAAGACTGAGAAGGAGGAGCCATTCAATGAGCATTGGCAGCAAATGCACAGACTTTGTCATCCATGTCAAATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18689
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140725 Nonsense 235 343 1 1
Genomic Location (Zv9):
Chromosome 1 (position 10777248)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 10909325
GRCz11 1 11596125
KASP Assay ID:
2261-7164.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGCCTTCAGAGCAGGTATCAGACCATCCTTCATTCACTTTATTCAGTA[T/G]CTGCTAGATCCAAAGACTGAGAAGGAGGAGCCATTCAATGAGCATTGGCA
Long Flanking Sequence:
CAGAAATCATTCACATTTGACCAGATTCCCAACAAAGCTCTGCACCATCTCATTGTGGACGATCATCACCGTGTGATTTACTGTTATGTACCCAAGGTAGCTTGTACTAACTGGAAACGAGTCATGTTTGCCCTCAGCCAGAACCTGAAGGCACCTGATGGAGCTCCATATCTGGATCTTCTTGACATACCATTAGAGATAATCCATAATTCTACAGTGCATAAGACATTTAGCAAGTTATGGATGCGTCATGGCCGATACGCTCGTCCTCTGATGCATCACAAGCTGAAGAACTACACTAAGTTCCTCTTTGTGCGGGATCCTTTTGTGCGCCTTATTTCTGCTTATCGAGACAAGCTTATGAAGCCAGATGAGTACTTCTACACCCATTATGGCTCCACAATGCTTCAGCGTTATGCTAATATTTCTCAGCCCCCTGATTCGGCTCAAGAGGCCTTCAGAGCAGGTATCAGACCATCCTTCATTCACTTTATTCAGTA[T/G]CTGCTAGATCCAAAGACTGAGAAGGAGGAGCCATTCAATGAGCATTGGCAGCAAATGCACAGACTTTGTCATCCATGTCAAATTGACTATGACTTTATTGGGAAGCTAGAAACTCTTGATGAGGACACAGAACATTTGCTGAAGATTCTTGGACTGGATAAACATATTCACTTTCCTCCAGGATATGAGAACAGGACTGCGGTAGACTGGGAGAAAGAATGGTTTGCTAACATTTCAGTAGCAGACAGGAGAAAGCTGTACAGTCTTTATGAAACCGACTTTAAGTTATTTGGATATGATAAACCTGAGACACTTCTGAATGAGTGACAAGTTATTGCTTGCTAAAAGAGAGGGTCACCGGTTGCTCTTTCTGGATTTACCTTCAAGGCCACATGTGATTTATAAACAATATTTGATAAATGCTGTTAAGACTGCACCTTTAAATGAAACAAGCTGAGCTTAAATTAACCTTCCGTAAAGCTGTGCATTTACCAAAACAT
Associated Phenotype:
Not determined