Busch Lab

ZMP

ms4a17a.5

Ensembl ID:
ENSDARG00000092204
ZFIN ID:
ZDB-GENE-040912-55
Description:
membrane-spanning 4-domains, subfamily A, member 17A.5 [Source:RefSeq peptide;Acc:NP_001004629]
Human Orthologues:
MS4A12, MS4A15, MS4A2, MS4A3, MS4A4A, MS4A8B, RP11-312N17.2
Human Descriptions:
Membrane-spanning 4-domains subfamily A member 18 [Source:UniProtKB/Swiss-Prot;Acc:Q3C1V0]
membrane-spanning 4-domains, subfamily A, member 12 [Source:HGNC Symbol;Acc:13370]
membrane-spanning 4-domains, subfamily A, member 15 [Source:HGNC Symbol;Acc:28573]
membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor fo
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) [Source:HGNC Symbol
membrane-spanning 4-domains, subfamily A, member 4 [Source:HGNC Symbol;Acc:13371]
membrane-spanning 4-domains, subfamily A, member 8B [Source:HGNC Symbol;Acc:13380]
Mouse Orthologues:
AC134839.1, Ms4a15, Ms4a2, Ms4a3, Ms4a4b, Ms4a4c, Ms4a4d, Ms4a8a
Mouse Descriptions:
membrane-spanning 4-domains, subfamily A, member 15 Gene [Source:MGI Symbol;Acc:MGI:3617853]
membrane-spanning 4-domains, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:95495]
membrane-spanning 4-domains, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2158468]
membrane-spanning 4-domains, subfamily A, member 4B Gene [Source:MGI Symbol;Acc:MGI:1913083]
membrane-spanning 4-domains, subfamily A, member 4C Gene [Source:MGI Symbol;Acc:MGI:1927656]
membrane-spanning 4-domains, subfamily A, member 4D Gene [Source:MGI Symbol;Acc:MGI:1913857]
membrane-spanning 4-domains, subfamily A, member 8A Gene [Source:MGI Symbol;Acc:MGI:1927657]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38444 Nonsense Mutation detected in F1 DNA Not yet available
sa26360 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38444
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075598 Nonsense 45 234 2 7
ENSDART00000147574 Nonsense 51 155 2 5
ENSDART00000147908 Nonsense 51 240 2 7
Genomic Location (Zv9):
Chromosome 4 (position 60704330)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75085455
GRCz11 4 76662193
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGCGTGTAGCAGGAGTTTCACCTCGTCAAGGAAATCAGGCCTTTCTT[A/T]AAGGCCAACCGAAAGCCCTCGGGGTGAGAAATCTCCCTTAAACCCAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26360
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075598 Essential Splice Site 90 234 4 7
ENSDART00000147574 Essential Splice Site 96 155 4 5
ENSDART00000147908 Essential Splice Site 96 240 4 7
Genomic Location (Zv9):
Chromosome 4 (position 60706073)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75087198
GRCz11 4 76663936
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATATATTTTCCAACATAAGCTGTAAGTTTTGCTCTTCTCTCTGTTCTC[A/G]GTACATTATTGCAGGCTCGCTCTCCATTGCTGCTGAAAACAAAATTAATT
Associated Phenotype:
Not determined