Busch Lab

ZMP

mhc1zel

Ensembl ID:
ENSDARG00000092162
ZFIN ID:
ZDB-GENE-091116-87
Description:
MHC class I antigen [Source:UniProtKB/TrEMBL;Acc:Q8MHB2]
Human Orthologues:
AL645933.1, AZGP1, FCGRT, HFE, MICB, MR1
Human Descriptions:
Fc fragment of IgG, receptor, transporter, alpha [Source:HGNC Symbol;Acc:3621]
MHC class I polypeptide-related sequence A isoform 2 (MICA*00801) precursor [Source:RefSeq peptide;
MHC class I polypeptide-related sequence B [Source:HGNC Symbol;Acc:7091]
alpha-2-glycoprotein 1, zinc-binding [Source:HGNC Symbol;Acc:910]
hemochromatosis [Source:HGNC Symbol;Acc:4886]
major histocompatibility complex, class I-related [Source:HGNC Symbol;Acc:4975]
Mouse Orthologues:
Azgp1, CR974466.3, Fcgrt, Gm11127, Gm7030, Gm8815, Gm8909, H2-Bl, H2-D1, H2-K1, H2-K2, H2-M2, H2-M3, H2-Q10, H2-Q2, H2-Q6, H2-Q7, H2-Q8, H2-T10, H2-T22, H2-T23, H2-T3, H2-gs10, Hfe, Mill1, Mill2, Mr1
Mouse Descriptions:
Fc receptor, IgG, alpha chain transporter Gene [Source:MGI Symbol;Acc:MGI:103017]
MHC I like leukocyte 1 Gene [Source:MGI Symbol;Acc:MGI:2179988]
MHC I like leukocyte 2 Gene [Source:MGI Symbol;Acc:MGI:2179989]
MHC class I like protein GS10 Gene [Source:MGI Symbol;Acc:MGI:3808875]
alpha-2-glycoprotein 1, zinc Gene [Source:MGI Symbol;Acc:MGI:103163]
hemochromatosis Gene [Source:MGI Symbol;Acc:MGI:109191]
histocompatibility 2, D region locus 1 Gene [Source:MGI Symbol;Acc:MGI:95896]
histocompatibility 2, K region locus 2 Pseudogene [Source:MGI Symbol;Acc:MGI:95906]
histocompatibility 2, K1, K region Gene [Source:MGI Symbol;Acc:MGI:95904]
histocompatibility 2, M region locus 2 Gene [Source:MGI Symbol;Acc:MGI:95914]
histocompatibility 2, M region locus 3 Gene [Source:MGI Symbol;Acc:MGI:95915]
histocompatibility 2, Q region locus 10 Gene [Source:MGI Symbol;Acc:MGI:95929]
histocompatibility 2, Q region locus 2 [Source:RefSeq peptide;Acc:NP_034522]
histocompatibility 2, Q region locus 2 Gene [Source:MGI Symbol;Acc:MGI:95931]
histocompatibility 2, Q region locus 6 Gene [Source:MGI Symbol;Acc:MGI:95935]
histocompatibility 2, Q region locus 7 Gene [Source:MGI Symbol;Acc:MGI:95936]
histocompatibility 2, Q region locus 8 Gene [Source:MGI Symbol;Acc:MGI:95937]
histocompatibility 2, T region locus 10 Gene [Source:MGI Symbol;Acc:MGI:95942]
histocompatibility 2, T region locus 22 Gene [Source:MGI Symbol;Acc:MGI:95956]
histocompatibility 2, T region locus 23 Gene [Source:MGI Symbol;Acc:MGI:95957]
histocompatibility 2, T region locus 3 Gene [Source:MGI Symbol;Acc:MGI:95959]
histocompatibility 2, blastocyst Gene [Source:MGI Symbol;Acc:MGI:892004]
major histocompatibility complex, class I-related Gene [Source:MGI Symbol;Acc:MGI:1195463]
predicted gene 11127 Gene [Source:MGI Symbol;Acc:MGI:3779381]
predicted gene 7030 Pseudogene [Source:MGI Symbol;Acc:MGI:3647514]
predicted gene 8815 Pseudogene [Source:MGI Symbol;Acc:MGI:3648635]
predicted gene 8909 Gene [Source:MGI Symbol;Acc:MGI:3704134]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15158 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15158
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135595 Nonsense 65 246 2 3
ENSDART00000140333 Nonsense 33 303 2 4
ENSDART00000145890 None None 358 None 5
Genomic Location (Zv9):
Chromosome 3 (position 1090514)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 596041
GRCz11 3 364690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTATAACCTTTTTTGTTGCTCTTCATCTTCAGAGAAGCACTCTCTGTA[T/G]TACATCTACACGRGTTTGTCCAAACCTSTGGATCTGCCGGGCATCTATGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25963
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135595 None None 246 None 3
ENSDART00000140333 None None 303 None 4
ENSDART00000145890 Nonsense 160 358 2 5
Genomic Location (Zv9):
Chromosome 3 (position 1075904)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 581431
GRCz11 3 350080
KASP Assay ID:
2259-2878.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTAATGTGAACGTCAACATACTGATGGACCGCATGAGACACAATATGT[C/A]AGGTGAGCAACACTCATACAATTTAACAGGCACATACACACAGTCCTAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25962
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135595 None None 246 None 3
ENSDART00000140333 None None 303 None 4
ENSDART00000145890 Nonsense 291 358 4 5
Genomic Location (Zv9):
Chromosome 3 (position 1075340)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 580867
GRCz10 3 584838
GRCz11 3 349516
GRCz11 3 353487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGAAACTCACCTGTCTGGCCACTGGCTTCTACGACAAAGACGTGATGT[T/A]GAACATTAGGAGAAATTGCCTGCCTGAAGATGAGACTGAATCTACAGGAG
Associated Phenotype:
Not determined