Busch Lab

ZMP

ank1

Ensembl ID:
ENSDARG00000092143
ZFIN ID:
ZDB-GENE-041010-44
Description:
ankyrin 1, erythrocytic [Source:RefSeq peptide;Acc:NP_001005969]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa14410 Nonsense Available for shipment Available now
sa14417 Nonsense Available for shipment Available now
sa40606 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14410
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917 None None 173 None 5
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917 None None 173 None 5
Genomic Location (Zv9):
Chromosome 5 (position 71832259)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68156877
GRCz11 5 68927544
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTYGGAGAGTTCAGAAGGGGCTGTAGGTCRCCAAGTYACCAACAACATT[A/T]AARAYGGTTCCAATGGAGGTTTGGGAGAAGGAGGAGGTGACGGCACACAG
Long Flanking Sequence:
TCACTCCAGGTTACGGGCTGGTGGTGCAGGAGGAACTAGTGTCACCGGCCTCCATGCAGTACAGTCTGCCCTCGCCACTGGGCAATGAGCCCTACTGGCAGGAGGTTTCCAGCATGGAGTGCGCGCCCATCGCCACCACTGAAGAAGACACGCTCATGGAGATGTCCGAGGTACAGGTTTGGCCCTCAGGAAATAGTCCGTCCATTGTGGCTGTAGAGGACTCCTCATTGGAGTGCAGCAATGCGGACGACTCCGAGGCGCTGCAGAACCGGAGCCTGGGTCACTCCAGGAGCGGGACGCCCGGTGGGAACGGACTCACTCCGGGAGGTTTAAGTGGCTCCATCGAGCTCCTGGAGGATCAGTCCATCGGTGCGGATTCAGACTACAGTGCCGCCGGGATGCTGCGTCTGAGCGAAGGGGTCAACATCAGTGCTCTGGACAGAGGTCAGAGGTCGGAGAGTTCAGAAGGGGCTGTAGGTCACCAAGTCACCAACAACATT[A/T]AAGACGGTTCCAATGGAGGTTTGGGAGAAGGAGGAGGTGACGGCACACAGTTAGAAGATAGCATATCTCTCATTTCAGGGCAACAGCGTGTGTATGCTCGAATGAGCGAGTCGCCTGGGCTGAGAAGACGGGCAGATCCTGGCGAAGACAGGTGAGCTGCTTATTGGGCTCGGAATTCTGTTGTGGACCAAAATGGCTTCTTCAGGAAGCATACTTGGGTAAACGTTTACAACTCTTAATTGTAAAGACTATTAAGGGCTCTGGGGTAAGCACTGTCGCTTTATGGCAAGTAGGTCACTGGTTCGAGTCCTGGCTGGACTAAATTTAACTAAATTGGCCATACTGTATGAATGTGAGAGTGTATGGGTGTTTGCCAGTGCCGGGTTGCAGCTGGAATGGCATCCGCTGCGTAACACATATGCCAGAATTGTTGGCCGTACATTCAGCAGTGGCGACCCCTGGTAAATAAGTCATTAAGCCAAAGTAAAATGAATGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14417
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917 None None 173 None 5
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917 None None 173 None 5
Genomic Location (Zv9):
Chromosome 5 (position 71832259)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68156877
GRCz11 5 68927544
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTYGGAGAGTTCAGAAGGGGCTGTAGGTCRCCAAGTYACCAACAACATT[A/T]AARAYGGTTCCAATGGAGGTTTGGGAGAAGGAGGAGGTGACGGCACACAG
Long Flanking Sequence:
TCACTCCAGGTTACGGGCTGGTGGTGCAGGAGGAACTAGTGTCACCGGCCTCCATGCAGTACAGTCTGCCCTCGCCACTGGGCAATGAGCCCTACTGGCAGGAGGTTTCCAGCATGGAGTGCGCGCCCATCGCCACCACTGAAGAAGACACGCTCATGGAGATGTCCGAGGTACAGGTTTGGCCCTCAGGAAATAGTCCGTCCATTGTGGCTGTAGAGGACTCCTCATTGGAGTGCAGCAATGCGGACGACTCCGAGGCGCTGCAGAACCGGAGCCTGGGTCACTCCAGGAGCGGGACGCCCGGTGGGAACGGACTCACTCCGGGAGGTTTAAGTGGCTCCATCGAGCTCCTGGAGGATCAGTCCATCGGTGCGGATTCAGACTACAGTGCCGCCGGGATGCTGCGTCTGAGCGAAGGGGTCAACATCAGTGCTCTGGACAGAGGTCAGAGGTCGGAGAGTTCAGAAGGGGCTGTAGGTCACCAAGTCACCAACAACATT[A/T]AAGACGGTTCCAATGGAGGTTTGGGAGAAGGAGGAGGTGACGGCACACAGTTAGAAGATAGCATATCTCTCATTTCAGGGCAACAGCGTGTGTATGCTCGAATGAGCGAGTCGCCTGGGCTGAGAAGACGGGCAGATCCTGGCGAAGACAGGTGAGCTGCTTATTGGGCTCGGAATTCTGTTGTGGACCAAAATGGCTTCTTCAGGAAGCATACTTGGGTAAACGTTTACAACTCTTAATTGTAAAGACTATTAAGGGCTCTGGGGTAAGCACTGTCGCTTTATGGCAAGTAGGTCACTGGTTCGAGTCCTGGCTGGACTAAATTTAACTAAATTGGCCATACTGTATGAATGTGAGAGTGTATGGGTGTTTGCCAGTGCCGGGTTGCAGCTGGAATGGCATCCGCTGCGTAACACATATGCCAGAATTGTTGGCCGTACATTCAGCAGTGGCGACCCCTGGTAAATAAGTCATTAAGCCAAAGTAAAATGAATGAATGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2255
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 122 267 2 4
ENSDART00000141917 None None 173 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 71828137)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68152755
GRCz11 5 68923422
KASP Assay ID:
554-3440.1 (used for ordering genotyping assays)
KASP Sequence:
TARTTTTCTTTCTCATTTCTCAGGTTAAGCRCAGGGTCGTTCCTGTCTTA[T/A]CTGCAGGATCAGGGCTCTCCTGGTTGGCATTCGGCTGCAGAAGCGACTCA
Long Flanking Sequence:
GTGTAGAGGAGACACAGAACAAAGTGAAAGTGAACAGCGGACAGGGGAGGAGGGCGGATGAGTAGGGAGATAGGTAAAATAAGGTGTCGGATCAGATTTCAGAAGTGCCGGATCCAGCTTGTTCCGGCACAAATTAAGCCCTGGTTCTCTCCCAGGACAGCATGCCAAACCTACTAACAAAGTCAAGCGTTATCTAAGTGTGAACTCTTGAACTGTAAATTATTCCCAAAATCAAAGGCAAATAATAGTTGGATAACAATCATGTAAACATAATCGTAAGTCTAAACCTAAGATAAACTGTAAACATATCCCTTAATTCTGATTGGCTGATTGGAATGTTGTTCCAGGATCAACATAGATGTTAATCCAGGAACATGTCCTACTTGGTGAAATCAGGTTAGGGCTCCCACTCTCAGTGTTCACTGCTGACCACGCTGTCATTACCTCCCCTAATTTTCTTTCTCATTTCTCAGGTTAAGCGCAGGGTCGTTCCTGTCTTA[T/A]CTGCAGGATCAGGGCTCTCCTGGTTGGCATTCGGCTGCAGAAGCGACTCAGAACAGATTGGCGTCTTTGCAATGCTCCCTTCCTAGGCAGGCAATAGAGTCTATGATGTCATCGGTGCGAGCTACGGTGGACTCTGACTCCAAGCAGTCTTGTTTGGGCCAGGAGGCTCTGATTGAGCCAGTGCGGGACATGGGGCACTCTGAGATCATCCATGGCCATTATCAGGGGACTCAGCCGTTTGAGAAAGGACTCGGCTTCCCGCACAGAACAACCAACATGCGCACTTGGGAGGACATGCGTCTGAGCGGACAGGTAAGAAGAGATTTAGTTTTATTGGATTAGATTTCATTCGCATTGTCACATACTGTACCAAGCACTTAATGTTTGCTATTGGCAGTGTAGAATCTTTGTGTGAAAGGTTTGACATTTTGGGGATGTAGTAGACAATTTATTTCACAGTAGGTCTCAAGTTGAAGGTGAAACGTGTTGTTTTTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40606
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053 Nonsense 109 152 3 3
ENSDART00000132838 None None 267 None 4
ENSDART00000141917 Nonsense 109 173 3 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 71811967)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68136585
GRCz11 5 68907252
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCCATCTGTACACGTGGCTGATGTAGATTGTGAGGAAAGTGGTCCGG[A/T]GAGGAAAAGGGGAGGAAGGGGGTCAGGAGCTGATCATTGAAGGTCTGCAG
Long Flanking Sequence:
AAAGCACCCTTAATAAATGGGTCATCGTTTACTCACCCTGGCCTTGTATTAAACCTTTATGAGTTTCTTTATTCTGTTGAACACGAAAGAAGATCATTTGAAGAATGCTGAATACCTGACTTCCATTGCTTTTCCTTCTATGGAAGTCAATGGTTACAGGTTTCCAGTTTTCTTCAAATGATCTTCTTTAGTGTTCAACAGAAGAAAGAAACTCATATGTGTTTGGAAACACTTGGGGGTGAGTAAACAGTGACGTTTTTTGGTGAACTATGCCTTCAACTCAAGATTACAGTATAGAAAATAGGTCAGATAGATGCATTGGGATGTTTCATGTTGACTTTAAATGCAACTTTTAATCACACTATTATTTTTGCATGTTGTTTTTCCCCATCTGTCACCCTGATTATCTGTTTTCATGTCTCCTCCTCGTCTGCTCATCCACCGATTCTCTCATCCATCTGTACACGTGGCTGATGTAGATTGTGAGGAAAGTGGTCCGG[A/T]GAGGAAAAGGGGAGGAAGGGGGTCAGGAGCTGATCATTGAAGGTCTGCAGCAGGATATCAGTGAGCCTGACTTTGATGGAGAACAGTTCATGAGCTATGCCGTCCTGGGACGTGACAGCAAGGTGGGCTTTTGAGTTAGATGAGGTGGTTTAAAAAGGGAAATGCAAAGATGCTTGTATAGTGAAAGTTTAGTAGATCAGGGAAACTGCAAAACACAAAGCGTTATTGGTGACATTACGATAAGGTTTCATTTGTGAAAAGGACATGGACTAAGAATAAACTAAAGCATTTATTAAATTCCCAAGTGTGATTTGTTTTTTGTTTTTGCATGCAGCTATGCAGAACAATTAGTGTTGTATTGCGACCAAGAGAGCTTAACTTGCTGCAATTACAAAAAACAATATAAATAGACTTGAAAACACTGCAGTATTTACTATAGTATCCATATATAATGAAATCCAAATGCATAAATGGTGCAGAATATAAAATATAATGCTAAT
Associated Phenotype:
Not determined