Busch Lab

ZMP

si:ch211-215e19.6

Ensembl ID:
ENSDARG00000091949
ZFIN ID:
ZDB-GENE-060503-874
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S4U8]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33050 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33050
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144934 Essential Splice Site 121 224 None 3
ENSDART00000146288 Essential Splice Site 123 170 None 3
Genomic Location (Zv9):
Chromosome 2 (position 52159258)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51524603
GRCz11 2 51258823
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGGGACACTAGACGCTGGTTATTATTTGTATCTGACGGTACAATCAGG[T/C]AAAGAAAACCTTTCAAAATCTCTATTATTTCTGATGAACAAATAATGTAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25925
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144934 Nonsense 149 224 3 3
ENSDART00000146288 Nonsense 151 170 3 3
Genomic Location (Zv9):
Chromosome 2 (position 52160685)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 51523176
GRCz11 2 51257396
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACATGAAGGTGGTAATGTCAGTGTTCAGTGTTTCTACAGTTCTGGATA[T/A]AAGGCTAAAACCAAACAGTGGTGCAGATTTAAAGATAAGAGCTGTTTCAC
Associated Phenotype:
Not determined