Busch Lab

ZMP

si:dkey-29d8.3

Ensembl ID:
ENSDARG00000091879
ZFIN IDs:
ZDB-GENE-030131-4226, ZDB-GENE-070912-508
Description:
wu:fc83f10 [Source:RefSeq peptide;Acc:NP_001104304]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa2043 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2043
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131369 Nonsense 111 294 3 7
ENSDART00000148045 Nonsense 75 232 2 7

The following transcripts of ENSDARG00000091879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 20982683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21528621
GRCz11 2 21186683
KASP Assay ID:
554-2803.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTGTATTCTTTGTTTCATGGATCATCAACCTGATTTTAAACTGCTCCT[G/A]GCTGGTCTTGTGGGATAGAGAGTAAGTTGTGGCCAACTTTCCTTTCACTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3386
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131369 Nonsense 249 294 6 7
ENSDART00000148045 Nonsense 213 232 5 7

The following transcripts of ENSDARG00000091879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 20987226)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21533164
GRCz11 2 21191226
KASP Assay ID:
2259-1875.1 (used for ordering genotyping assays)
KASP Sequence:
GTTTACCCTGTGATTRTCTATGCTCTGTCTGGAAGCCTAAGCAAGCATTA[T/G]GACTCAACAGCTCCAGGYCGGAATGYAGTCTTTTCAGGTTAGTCAATGAT
Associated Phenotype:
Not determined