Busch Lab

ZMP

ENSDARG00000091803

Ensembl ID:
ENSDARG00000091803
Human Orthologue:
AC092718.1
Mouse Orthologues:
Pkd1l2, Pkd1l3
Mouse Descriptions:
polycystic kidney disease 1 like 2 Gene [Source:MGI Symbol;Acc:MGI:2664668]
polycystic kidney disease 1 like 3 Gene [Source:MGI Symbol;Acc:MGI:2664670]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41041 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18895 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41041
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124378 Essential Splice Site 449 1083 9 21
Genomic Location (Zv9):
Chromosome 7 (position 57774228)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56209554
GRCz11 7 56510965
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGACAAACATCAGCTCTTGGAATCAAAGCACTACTGTGACCTATAAAG[G/A]TAACTTTGAAAAATAAATTCAGTGGTTTACTTAAATGGGTTGTGTATAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18895
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124378 Nonsense 986 1083 19 21
Genomic Location (Zv9):
Chromosome 7 (position 57756086)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56191412
GRCz11 7 56492823
KASP Assay ID:
554-6158.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGTAGTTCAAGTACAGAAGAAGAAGCAGGGCTGGTGGTTGCCCTGGTG[G/A]TTTCTGTTCATCGGCTGGTTTCTGCTTTTTGTCATGAGTGGTATTTCCAC
Associated Phenotype:
Not determined