Busch Lab

ZMP

NPFFR1

Ensembl ID:
ENSDARG00000091788
Description:
neuropeptide FF receptor 1 [Source:HGNC Symbol;Acc:17425]
Human Orthologue:
NPFFR1
Human Description:
neuropeptide FF receptor 1 [Source:HGNC Symbol;Acc:17425]
Mouse Orthologue:
Npffr1
Mouse Description:
neuropeptide FF receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2685082]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16924 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7708
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122364 Essential Splice Site 41 297 1 2
Genomic Location (Zv9):
Chromosome 12 (position 49474898)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48144139
GRCz11 12 48127742
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGTCGGTCTCTGCATCTGTCTTCACACTGGTGGTGATCGCAGTGGAAAG[G/A]TTAATAACTCTCCTTTCCTACACACACYTCATATATAATCATAACAATAA
Long Flanking Sequence:
AGAACAAACCACTGTTATACAATGACTTGCCTAATTACCCTAACTTTACCCTAATTACCCTAGTGAAGCCTTTACATGTCACTTTAAGCTGAACACTAGTGTCTTGAAGAATATCTAGTCTAATATTATTTACTGTCATCATGACAGAGAGAAAATAAATCAGTTATTAAAAGTAAATAAATGCACTCACATGAACCTTAATTCATTTCAAATGTTTACCATCTATCATATGCAAATTAATTCAGATTTTGTGATATGTTTTTTGCATACACTGCCATATATCAGATTTCTATAGTGAGTCACTTTGCATTGCAGCAGCTTCTGCTTGGCATTACAGTAAGTGTTGTTTACTCACTCAGGAATATGCAGTAAGGTCAGATGTGTGTGTTCTCTCCATCAGGCTGGCCGTTTGATGCAGTGGTGTGTAAAATGAGTGGTCTCGTCCAGGGAGCGTCGGTCTCTGCATCTGTCTTCACACTGGTGGTGATCGCAGTGGAAAG[G/A]TTAATAACTCTCCTTTCCTACACACACTTCATATATAATCATAACAATAAACAGCGCCTGCATCTCTATCATGCCCTGAGACTGTCACACCTCGGCAAATCTCCACTATACATTCACAGAAACACTGAGAATAGTGTGCAAAAAGCATGCAAACTCTGATTTTACACTACTGTAAGTATGAGTAATAAATATAAAATTAATAAGTGACTTTATGTAGACTTTCTTCTCAAATATTTACCTTTTCTAATCACATTTTGTAATTTTGATGTTGGCTTTATTTCATAATATTGACTTTCTTTACATATTTAGTGATTTTTTTTGTGATAATTACATTATAATTTTGAGAAACATTTAAGTATGTTTTTTTAAATACTGAGGCTTTCACACTTCAAGGAATCTTCATATAATCTCAGAAACACAGAATAATGTGCAGAAAGCATTCAAACATGGTTTTACAGTACAATAAGTACAAGTAATAAGTATATATTCTATAATAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16924
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122364 Nonsense 104 297 2 2
Genomic Location (Zv9):
Chromosome 12 (position 49469247)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48138488
GRCz11 12 48122091
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTTCATGGTGGACCGAGACAACATCACGTACCCSCTGTTCACCTGCTG[G/A]GAGGCCTGGCCTGACCAGAGCATGAGGAAGATCTACACCACCGTGCTCTT
Long Flanking Sequence:
CCAATCAGATCGCTGTATGCAAATACACCAGCTCAGACAGTGGCCTATTGCTGACTGAATTTCATTGGCTGATGCTTCTATGACGATCGTTTCAGCTCCAACTTCAGACACGCCTTCAGTCAAGCGTTGACGCTGAAGCCTCGTGTGAATGGGATCACTACAAAGGCAAGAACATCCAGCTCCCTCAGGACTGTGCATTCAGAACAGAAAGACAAGAGACATTTAAATGACAAGACATGAGAGTCTAAAACAAGAATAAACATGACTGAAGTGGTGGAGTTCTGACAGTTCTCCTTCTGCTGTGTTTGCAGGTTTCGATGTATTGTGTACCCCTTCCAGCAGAAGCTGACACGCCGCCAGGCCATCATCACCATCGCCTTCATCTGGGCTCTGGCCATCGCCATCATGTGCCCGTCTGCCGTCACGCTGACCGTCTCGCAGGACGTCCTGCACTTCATGGTGGACCGAGACAACATCACGTACCCGCTGTTCACCTGCTG[G/A]GAGGCCTGGCCTGACCAGAGCATGAGGAAGATCTACACCACCGTGCTCTTCTCACACATATACCTAGCTCCGGTCACGCTCATCGCCATCATGTACACCCGCATCGCCCTCAAGCTGGTCCGGTCGCCCGCATCAATCCGGGACGCCCAGGCGGAGGACGAGAGCCGGAGGGTTTTCCGCAGAAAGCTGCGCGTGGTCAACATGCTCCTGATGGTGGCGCTGCTGTTCACCGTCTCCTGGCTGCCGCTCTGGATCCTCATGATGCTGACGGATTACGGAAACCTGACGGAGGCTCAGTTGGATTTCGTGGCTGTTTACGTGTTCCCGTTCGCCCATTGGCTGGCCTTCTTCAACAGCAGCGTCAATCCAATAGTCTATGGGTATTTTAATGAGAATTTCCGGCGGGGGTTTCAGGCGGCGTTTAAGATGGGGATGTGTTTAGTGGAGCCGCCGCAGCCCAGACGCAACGGCACGTGGAAACACAACCGTGTGTTTGTGGA
Associated Phenotype:
Not determined