Busch Lab

ZMP

ints12

Ensembl ID:
ENSDARG00000091678
ZFIN ID:
ZDB-GENE-040625-178
Description:
Integrator complex subunit 12 [Source:UniProtKB/Swiss-Prot;Acc:Q6IQU7]
Human Orthologue:
INTS12
Human Description:
integrator complex subunit 12 [Source:HGNC Symbol;Acc:25067]
Mouse Orthologue:
Ints12
Mouse Description:
integrator complex subunit 12 Gene [Source:MGI Symbol;Acc:MGI:1919043]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25585
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125690 Essential Splice Site 107 479 3 6

The following transcripts of ENSDARG00000091678 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25325809)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25749507
GRCz11 1 26443221
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACTGGAAATTCTCAGCATAATTCACTTTTGAATATTTGTATGATTTAAA[G/A]ATTAGGGTTGATCCTGGAGAAGGAGTGGAGCCGCCTAAGAAACCTCGTTT
Associated Phenotype:
Not determined